Psmc3ip (NM_008949) Mouse Untagged Clone
CAT#: MC204035
Psmc3ip (untagged) - Mouse proteasome (prosome, macropain) 26S subunit, ATPase 3, interacting protein (Psmc3ip), (10ug)
CNY 2400.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | C79099; GT198; HOP2; Tbpip |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC030169
CCACGCGTCCGCTCGAGTTTGGTGGCGAGAAAGGCCATGAGTAAAAGCCGGGCCGAGGCTGCGGCTGGAG CCCCCGGGATCATCCTGAGGTACCTGCAAGAACAAAACCGGCCCTACAGCGCCCAGGACGTGTTCGGAAA CCTACAGAAGGAACATGGACTGGGCAAGGCGGCGGTAGTGAAGGCGCTGGATCAGCTGGCCCAGGAAGGC AAGATCAAAGAGAAGACCTACGGCAAGCAGAAAATTTATTTTGCCGATCAGAACCAGTTTGACACAGTGA GTGATGCGGACCTCCACGGCCTGGATGCCAGTATCGTGGCCCTCACTGCCAAGGTGCAGAGCTTACAGCA GAGCTGCCGACACATGGAGGCCGAGCTGAAGGAATTAACAAGTGCGCTGACCACTCCTGAGATGCAGAAA GAGATTCAGGAGTTAAAGAAGGAGTGTGCTCAATACACAGAGAGACTGAAGAACATCAAAGCAGCTACCA ACCATGTCACTCCAGAAGAGAAGGAGAAGGTGTACAGAGACAGACAGAAGTACTGTAAAGAGTGGAGGAA GCGGAAGAGGATGACCACAGAGCTGTGTGATGCGATCCTTGAAGGCTACCCCAAGAGCAAGAAGCAGTTC TTTGAGGAAGTTGGAATAGAGACAGATGAAGATCATAATGTTTTGCTCCCCGACCCCTGAGGGGCCCTTG GTGGAGGTGGGAACAGAGCGTCCTGCGCTGGCCACCTTACTTAGTGGCCTTTTTATTCTTGCTGTTCTCC ACCTTTGAGCAGTGGACGGAGCACAAAGCCATAGTGTTAGATAGAGGCTGGTGATCAGAAAGGACGGTCA TGTCCGTTTTGTACAGGCCTCAACAAGGACTTAAAACAATCCTAAAAGAAAGTATTTGTAATATTTATTG TAATATAATTTGATATAAAAATAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_008949 |
Insert Size | 654 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC030169, AAH30169 |
RefSeq Size | 948 bp |
RefSeq ORF | 654 bp |
Locus ID | 19183 |
UniProt ID | O35047 |
Gene Summary | Plays an important role in meiotic recombination. Stimulates DMC1-mediated strand exchange required for pairing homologous chromosomes during meiosis. The complex PSMC3IP/MND1 binds DNA, stimulates the recombinase activity of DMC1 as well as DMC1 D-loop formation from double-strand DNA. This complex stabilizes presynaptic RAD51 and DMC1 filaments formed on single strand DNA to capture double-strand DNA. This complex stimulates both synaptic and presynaptic critical steps in RAD51 and DMC1-promoted homologous pairing. May inhibit HIV-1 viral protein TAT activity and modulate the activity of proteasomes through association with PSMC3.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202419 | Psmc3ip (tGFP-tagged) - Mouse proteasome (prosome, macropain) 26S subunit, ATPase 3, interacting protein (Psmc3ip) |
CNY 2850.00 |
|
MR202419 | Psmc3ip (Myc-DDK-tagged) - Mouse proteasome (prosome, macropain) 26S subunit, ATPase 3, interacting protein (Psmc3ip) |
CNY 2400.00 |
|
MR202419L3 | Lenti ORF clone of Psmc3ip (Myc-DDK-tagged) - Mouse proteasome (prosome, macropain) 26S subunit, ATPase 3, interacting protein (Psmc3ip) |
CNY 4750.00 |
|
MR202419L4 | Lenti ORF clone of Psmc3ip (mGFP-tagged) - Mouse proteasome (prosome, macropain) 26S subunit, ATPase 3, interacting protein (Psmc3ip) |
CNY 4750.00 |
其它Psmc3ip产品