Psmc3ip (NM_008949) Mouse Untagged Clone

CAT#: MC204035

Psmc3ip (untagged) - Mouse proteasome (prosome, macropain) 26S subunit, ATPase 3, interacting protein (Psmc3ip), (10ug)



  "NM_008949" in other vectors (4)

CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms C79099; GT198; HOP2; Tbpip
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC030169
CCACGCGTCCGCTCGAGTTTGGTGGCGAGAAAGGCCATGAGTAAAAGCCGGGCCGAGGCTGCGGCTGGAG CCCCCGGGATCATCCTGAGGTACCTGCAAGAACAAAACCGGCCCTACAGCGCCCAGGACGTGTTCGGAAA CCTACAGAAGGAACATGGACTGGGCAAGGCGGCGGTAGTGAAGGCGCTGGATCAGCTGGCCCAGGAAGGC AAGATCAAAGAGAAGACCTACGGCAAGCAGAAAATTTATTTTGCCGATCAGAACCAGTTTGACACAGTGA GTGATGCGGACCTCCACGGCCTGGATGCCAGTATCGTGGCCCTCACTGCCAAGGTGCAGAGCTTACAGCA GAGCTGCCGACACATGGAGGCCGAGCTGAAGGAATTAACAAGTGCGCTGACCACTCCTGAGATGCAGAAA GAGATTCAGGAGTTAAAGAAGGAGTGTGCTCAATACACAGAGAGACTGAAGAACATCAAAGCAGCTACCA ACCATGTCACTCCAGAAGAGAAGGAGAAGGTGTACAGAGACAGACAGAAGTACTGTAAAGAGTGGAGGAA GCGGAAGAGGATGACCACAGAGCTGTGTGATGCGATCCTTGAAGGCTACCCCAAGAGCAAGAAGCAGTTC TTTGAGGAAGTTGGAATAGAGACAGATGAAGATCATAATGTTTTGCTCCCCGACCCCTGAGGGGCCCTTG GTGGAGGTGGGAACAGAGCGTCCTGCGCTGGCCACCTTACTTAGTGGCCTTTTTATTCTTGCTGTTCTCC ACCTTTGAGCAGTGGACGGAGCACAAAGCCATAGTGTTAGATAGAGGCTGGTGATCAGAAAGGACGGTCA TGTCCGTTTTGTACAGGCCTCAACAAGGACTTAAAACAATCCTAAAAGAAAGTATTTGTAATATTTATTG TAATATAATTTGATATAAAAATAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_008949
Insert Size 654 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC030169, AAH30169
RefSeq Size 948 bp
RefSeq ORF 654 bp
Locus ID 19183
UniProt ID O35047
Gene Summary Plays an important role in meiotic recombination. Stimulates DMC1-mediated strand exchange required for pairing homologous chromosomes during meiosis. The complex PSMC3IP/MND1 binds DNA, stimulates the recombinase activity of DMC1 as well as DMC1 D-loop formation from double-strand DNA. This complex stabilizes presynaptic RAD51 and DMC1 filaments formed on single strand DNA to capture double-strand DNA. This complex stimulates both synaptic and presynaptic critical steps in RAD51 and DMC1-promoted homologous pairing. May inhibit HIV-1 viral protein TAT activity and modulate the activity of proteasomes through association with PSMC3.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...