Sf3b6 (NM_025323) Mouse Untagged Clone

CAT#: MC203917

0610009D07Rik (untagged) - Mouse RIKEN cDNA 0610009D07 gene (0610009D07Rik), (10ug)



  "NM_025323" in other vectors (4)

CNY 1200.00

CNY 2000.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 0610009D07Rik; 6030419K15Rik; AV001342; Sf3b14
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC019535
GCATCTTTTCTAGGAAGTAAACGCGTCCTAATTTGAGACGCGGACTTTCCGGCATTGCTGTAAAAGCTTC CGGCGCTACCTGGCTGTAAATACTCTGTATCTGACGCCGTGTCGCCCACGAAGGCGATCAGGTTTAGAAA TATCCAGAGGGATCTTACGGTAACCTACATCAGCCCGCCAAGATGGCGATGCAAGCGGCTAAGAGGGCGA ATATTCGCCTCCCACCTGAAGTAAATCGGATTTTGTATATAAGGAATTTGCCATACAAAATCACAGCAGA AGAAATGTATGATATATTTGGGAAATATGGACCTATTCGTCAAATCAGAGTAGGGAATACACCTGAAACC AGAGGAACAGCCTATGTGGTCTATGAGGACATCTTTGATGCTAAGAATGCCTGCGACCACCTATCAGGAT TCAACGTTTGTAACAGATACCTTGTGGTTTTGTATTACAATGCTAACCGGGCATTTCAGAAGATGGACAC CAAGAAGAAGGAGGAGCAGCTGAAACTTCTCAAGGAAAAGTATGGCATCAACACAGATCCTCCCAAGTGA ATGACAGCCACGCGTGGTCCTGGTTACCTGTTCTCTTCTCTTCCTTTTTAATTAGTACTGAATATTGTGA TTTCTTATTTGAGAACTAGAATGACTTATGTGAAAGTTTTCTAGCATTAGAAAATATAATGTTAATAAAC TTGTAGCTTTTTTCTATAATGTGTCTTCTGTTAAACTTCTCACTTCTTTTTCCTAATATCAGTAGAAAAC AAATGAGGAGAAACACATGTAGGTTATAGATGAGCTAAGGACTGAGGTGCTTGTGCTGGGGACGCTCGGC CTGGGGAGCCTGGCTGTTAGCAGTGTAACCTCAGTGGAGTGCTGTGTTGCTGTGAGCAAGACCTCACCCT ACCGCCTAGAGGTCAGTCTTCTACTAGCAGCCTTAGGGTGAAGATGTAGAACTCTCAGCTCTGCCTGTAC CATGCCAGCCTGGGTGCCATCATGATAATGGACTGGGCCTCTGAACCTGTAAGCCAGCCCCAGTTAAATG TTGTCCTTATAAAACTTGCCTTGGTCATGATGTCTGCTCACAGCCTTAAAACCCTTAAAACACTGAAAAA AAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_025323
Insert Size 378 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC019535, AAH19535
RefSeq Size 1133 bp
RefSeq ORF 378 bp
Locus ID 66055
UniProt ID P59708
Gene Summary Involved in pre-mRNA splicing as a component of the splicing factor SF3B complex. SF3B complex is required for 'A' complex assembly formed by the stable binding of U2 snRNP to the branchpoint sequence (BPS) in pre-mRNA. Directly contacts the pre-mRNA branch site adenosine for the first catalytic step of splicing. Enters the spliceosome and associates with the pre-mRNA branch site as part of the 17S U2 or, in the case of the minor spliceosome, as part of the 18S U11/U12 snRNP complex, and thus may facilitate the interaction of these snRNP with the branch sites of U2 and U12 respectively.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...