Fhit (NM_010210) Mouse Untagged Clone
CAT#: MC203768
Fhit (untagged) - Mouse fragile histidine triad gene (Fhit), (10ug)
CNY 1200.00
CNY 2000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AW045638; Fra1; Fra14A2 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC012662
CCACGCGTCCGGCTTCCTCCTCTTCCTGTGGATCAGTCCTCTGCTTGGAAAACACAGCTTTTACTGTGAG ACCATGTCATTTAGATTTGGCCAACATCTCATCAAGCCCTCTGTGGTTTTTCTCAAAACTGAACTGTCCT TCGCCCTGGTGAATAGGAAACCCGTTGTACCTGGCCATGTCCTCGTGTGCCCGCTGAGGCCAGTAGAGCG CTTCCGTGACCTACATCCTGATGAAGTGGCCGATTTGTTTCAAGTGACCCAGAGAGTTGGGACAGTGGTG GAGAAGCATTTCCAGGGGACCTCCATCACCTTCTCCATGCAAGATGGTCCTGAAGCTGGGCAGACTGTGA AGCATGTACATGTCCACGTTCTTCCCAGGAAGGCAGGGGACTTCCCCCGGAATGACAACATCTATGATGA GCTCCAGAAACATGACAGAGAAGAAGAGGACTCGCCAGCCTTTTGGAGATCTGAGGAGGAGATGGCTGCA GAGGCGGAGGCTCTGCGGGTCTACTTTCAGGCCTGAGAGTAACTCAAACGATTCCCAAGGCATAAGAAAA TGGACCCCATTCTTCTGGAGTCTTCGACATTGGAAATGAAGCTAACCACTCTTTATTGTACCCCACGACC CCACAGCCTTGTACAAAGAACTTTATTGCATGTGTGGAAGCCACTAGTATTATGCTTCCATCACGATGAC AAATAGGCTAGCTTCCCAAACAGTGGCATTGACAGCCTGCCACCGTTCCTCAGTTCTGTACTTAGAATAG TAACATTTCCAAACTGTCCCTGAGCCTAGATGAAAATAAAGTGGTTGCTAAAATATTAAAAAAAAAAAAA AA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_010210 |
| Insert Size | 453 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC012662, AAH12662 |
| RefSeq Size | 842 bp |
| RefSeq ORF | 453 bp |
| Locus ID | 14198 |
| UniProt ID | O89106 |
| Gene Summary | This gene encodes a member of the HIT family of proteins that are characterized by the presence of a histidine triad sequence. The encoded protein is a diadenosine triphosphate hydrolase enzyme that cleaves the P(1)-P(3)-bis(5'-adenosyl) triphosphate (Ap3A) to yield AMP and ADP. This locus is very fragile and has been found to be altered in different types of cancers. Mice lacking the encoded protein display increased susceptibility to spontaneous and induced tumors. Ectopic expression of the encoded protein in such knockout mice inhibits tumor development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015] Transcript Variant: This variant (2) lacks an alternate exon in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1. Variants 2, 3 and 4 encode the same protein (isoform 2). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201063 | Fhit (tGFP-tagged) - Mouse fragile histidine triad gene (Fhit) |
CNY 2850.00 |
|
| MR201063 | Fhit (Myc-DDK-tagged) - Mouse fragile histidine triad gene (Fhit) |
CNY 1200.00 |
|
| MR201063L3 | Lenti ORF clone of Fhit (Myc-DDK-tagged) - Mouse fragile histidine triad gene (Fhit) |
CNY 4750.00 |
|
| MR201063L4 | Lenti ORF clone of Fhit (mGFP-tagged) - Mouse fragile histidine triad gene (Fhit) |
CNY 4750.00 |
