Mrpl18 (NM_026310) Mouse Untagged Clone

CAT#: MC203726

Mrpl18 (untagged) - Mouse mitochondrial ribosomal protein L18 (Mrpl18), nuclear gene encoding mitochondrial protein, (10ug)



  "NM_026310" in other vectors (4)

CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Mrpl18 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1010001C05Rik; C79879; HSPC071; MRP-L18
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC011425
GTTCCCCGAGACGACCCTGAGCAAAGGAAGATAGGGCACTGTGTGACTTTGCCCAGGTCCCGTCAGCCAT GGCGCTTCGGCCGCGGTTCTGGAAATGTCTGTCAGTTTGCAGGAAACTGGAGTGTGGGTTCGCAGCCCTC TCAACCAGTTCCGTGCCGGCCGTGCAGCCCGACGTGGAGAGTAAGGAAAACGAAGCGGTGGCCCCGGAGT TCACCAACCGGAACCCTCGGAATCTGGAGCTCTTAGGGGTAGCTCGGAAAGAACGGGGCTGGGCTACCGT GTGGCCTAACCGTGAGTTCTGGCACAGGTTGCGAGTTGTAAAGACTCAGCATCACGTAGAAGCATTTGTT GAGCATCTTAACGGCCAGGTTGTTGTTTCAGCATCCACTCGAGAATGGGCTATTAAAAAACACCTTTATA GTACCAGAAACGTGGTGGCTTGTGAGAGCATTGGGCGAGTGCTGGCACAGCGGTGCTTAGAAGCAGGAAT CAACTTCATGGTCTACCAGCCCACCCCGTGGGAGGCGTCCTCAGACTCGATAAAACGTTTACAAAATGCC ATGACAGAAAGTGGCGTGATGCTTCGGGAGCCTCGAAGAATCTATGAATGAAATAGAAGTGTTAACTGTT GTTGGCAGTGTAATATAAAACTACCATCTACAGCCACCAAAGGAAAGCATCTGCATTAAAAGGAAGAAAG GAAGGAAGGAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_026310
Insert Size 543 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC011425, AAH11425
RefSeq Size 724 bp
RefSeq ORF 543 bp
Locus ID 67681
UniProt ID Q9CQL5
Gene Summary Together with thiosulfate sulfurtransferase (TST), acts as a mitochondrial import factor for the cytosolic 5S rRNA. The precursor form shows RNA chaperone activity; is able to fold the 5S rRNA into an import-competent conformation that is recognized by rhodanese (TST). Both the cytoplasmic and mitochondrial forms are able to bind to the helix IV-loop D in the gamma domain of the 5S rRNA (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...