Gtf2b (NM_145546) Mouse Untagged Clone
CAT#: MC203695
Gtf2b (untagged) - Mouse general transcription factor IIB (Gtf2b), (10ug)
CNY 2400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | MGC6859 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC016637
CGGAGCTGTTGGCGGAGCCGCGAAGATGGCGTCGACCAGCCGTTTGGATGCTCTCCCAAGAGTCACATGT CCGAATCATCCAGATGCAATTTTAGTTGAAGACTACAGAGCTGGCGATATGATCTGTCCCGAATGTGGCC TAGTTGTAGGGGACCGAGTTATTGATGTGGGATCTGAATGGAGAACTTTCAGCAATGACAAAGCAACAAA AGACCCATCTAGAGTTGGAGACTCTCAGAATCCTCTTCTGAGTGATGGAGATTTGTCCACCATGATTGGC AAGGGTACAGGAGCTGCAAGTTTTGATGAGTTTGGCAATTCTAAGTATCAGAACCGGAGAACAATGAGTA GCTCTGATCGAGCAATGATGAACGCATTCAAGGAAATCACGACCATGGCGGACAGAATCAACCTCCCTCG CAATATAGTTGATCGAACAAATAATTTATTCAAGCAAGTGTATGAGCAGAAGAGCCTGAAGGGCAGAGCT AATGACGCGATAGCCTCTGCTTGTCTGTACATCGCCTGTAGACAAGAAGGCGTTCCCAGGACATTTAAAG AAATATGTGCTGTGTCTCGAATCTCTAAGAAAGAAATTGGCCGCTGTTTTAAACTGATTTTGAAAGCTCT GGAAACCAGCGTGGATCTGATCACAACTGGGGACTTCATGTCCAGGTTCTGCTCCAACCTTTGCCTCCCC AAGCAAGTGCAGATGGCAGCTACACACATAGCCCGCAAGGCAGTGGAGCTGGACTTGGTTCCTGGCAGGA GCCCGATCTCTGTGGCGGCAGCAGCTATTTACATGGCTTCCCAGGCTTCAGCTGAGAAGCGAACACAGAA AGAAATCGGGGATATTGCTGGTGTTGCTGATGTTACAATCCGACAGTCCTACAGACTGATCTACCCTCGG GCTCCGGATCTCTTCCCTTCAGACTTCAAGTTTGACACCCCAGTGGACAAATTACCCCAGCTATAAGCTG AGGCAACTAAGTGTCACACTCTTAATGTACATGGAATATGGAACTTTGTACATAGCCACACAGTGCTGGT TGAGCCTTTAATGAGGAAAAAGGAGATGGTACCCATTCCAGAGCTAAATATTATTGCTTAGTCTTCTGTA TGTATATACTAGTGCAACATATTTAATGACTTAAATTTCTTACTGAATCTGCTTTCTTTTTTAGTGATCT AGGAAACAGTATTTTGGAAGGTATTAAAATAATGTAATTCTCAAATAAAAATTTAAAACCAAAAAAAAAA AAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_145546 |
| Insert Size | 951 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC016637, AAH16637 |
| RefSeq Size | 1267 bp |
| RefSeq ORF | 951 bp |
| Locus ID | 229906 |
| UniProt ID | P62915 |
| Gene Summary | General transcription factor that plays a role in transcription initiation by RNA polymerase II (Pol II). Involved in the pre-initiation complex (PIC) formation and Pol II recruitment at promoter DNA. Together with the TATA box-bound TBP forms the core initiation complex and provides a bridge between TBP and the Pol II-TFIIF complex. Released from the PIC early following the onset of transcription during the initiation and elongation transition and reassociates with TBP during the next transcription cycle. Associates with chromatin to core promoter-specific regions. Binds to two distinct DNA core promoter consensus sequence elements in a TBP-independent manner; these IIB-recognition elements (BREs) are localized immediately upstream (BREu), 5'-[GC][GC][GA]CGCC-3', and downstream (BREd), 5'-[GA]T[TGA][TG][GT][TG][TG]-3', of the TATA box element. Modulates transcription start site selection. Exhibits also autoacetyltransferase activity that contributes to the activated transcription.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG204535 | Gtf2b (tGFP-tagged) - Mouse general transcription factor IIB (Gtf2b) |
CNY 2850.00 |
|
| MR204535 | Gtf2b (Myc-DDK-tagged) - Mouse general transcription factor IIB (Gtf2b) |
CNY 2400.00 |
|
| MR204535L3 | Lenti ORF clone of Gtf2b (Myc-DDK-tagged) - Mouse general transcription factor IIB (Gtf2b) |
CNY 4750.00 |
|
| MR204535L4 | Lenti ORF clone of Gtf2b (mGFP-tagged) - Mouse general transcription factor IIB (Gtf2b) |
CNY 4750.00 |
