Tmem216 (NM_026798) Mouse Untagged Clone

CAT#: MC203636

Tmem216 (untagged) - Mouse transmembrane protein 216 (Tmem216), (10ug)



  "NM_026798" in other vectors (4)

CNY 1200.00

CNY 2000.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1110017C22Rik; 2810441K11Rik; 4921533J23Rik; A930021F15Rik; AI482550
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC052053
CATGGCGCCGCGAGGTGAGACTCTGGAGATAAAAGATTGTCCTCAACCCCCCTGGAAGTCCTGTTCTTTC TGAATGGGTGGTACTATGCTACCTATTTCCTGCTGGAGCTCCTTATTTTCCTGTACAAAGGGCTCCTGTT GCCGTACCCAACAGCCAACTTAGTCCTGGATGTGGTGATGCTGCTGCTCTATCTTGGCATTGAAGTCATA CGATTGTTTTTCGGTACAAAGGGAAACCTCTGCCAGCGAAAGATGCCCCTTGGCATTAGTGTGGCCTTGA CCTTCCCATCCGCTATGATGGCTTCCTATTACCTGCTGCTGCAGACCTACGTGCTCCGCCTAGAAGCTAT CATGAACAGTATCTTGCTCTTCTTTTGTGGCTCAGAGCTGCTGCTTGAGATGCTCACGCTGGCCACCTTC TCCAGCATGGACAGGATCTGAAGTACAAGAATTCCAGCTGGTGACAACACATATCCATCTGGTACTTCAG CCACACTGGTGAAAAGTGGTAGGTCGAGCTAACCTGGGAAAGGTTTGTGTGGTTTTTCCTCAGTGCGGAC ATTTGGGCGCTGAGCACCTACCTGAGGCCAGTGGCACCATCTTTAAAGCGGGATCATCAGCAGGAGACTC TTTCCTTTTGTTGTAGGGAGGGGCAAGGCTGTCCCCATCTTGGTGTTTCTAACAGCTTCCTAATGATCTC AAGTTCTCTTCTGTGGTCATCATGGCCAGAGCACCTTGTGTGGACCTTCTAGTTTTGTTTGGCTTCCAGC AGAACCTGAGCCACAGCACTCTGTGCACGTACATCTGTCCTACATGACCATGGAGAGCCTCATAATGGTG GGCTCTTGGGCTGATTCCAATGTGTGTTCTCCACGCTGCTCCACCTGCCCCCATCCTGCTCAAAGAGATG GTGATCTAGAACCCATTTAGTAGTTTATAGTAGTATTTTTCTATTCTGATCATGAAGCAAACACAAAATT TTTAATAAAAGTATTTTCTGATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAA
Restriction Sites AscI-NotI     
ACCN NM_026798
Insert Size 264 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC052053, AAH52053
RefSeq Size 1053 bp
RefSeq ORF 264 bp
Locus ID 68642
UniProt ID Q9CQC4
Gene Summary This gene encodes a transmembrane protein which is involved in regulation of signaling and trafficking of associated proteins. In humans, mutations in this gene are associated with ciliopathies including Joubert, Meckel and related syndromes. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2013]
Transcript Variant: This variant (2) contains an alternate 5' terminal exon, differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. Variants 2 and 3 encode the same isoform (2), which has a shorter N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...