Rpsa (NM_011029) Mouse Untagged Clone
CAT#: MC203581
Rpsa (untagged) - Mouse ribosomal protein SA (Rpsa), (10ug)
CNY 2400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 67kDa; 67lr; AL022858; Lamr; Lamr1; Lamrl1; MLR; P40; P40-3; P40-8 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC055886
TGCTGACAAAGTCACTTTCCTTAGTGACTAGGTGGCCAGAAAAATCGAAAGGCAAGGAGGAATAAGAACA CAACCCATTTCAGCTCAGATGATGTGCTGCGCCTAGTGGCATACGCCTTTAGTCCCCCTCTCAGGAGGCA GGGCAATCTTGTGAGTTCTAGTGTCAGAAGAAAAAAGATGAATTTTATTCCTTTTTTAGATTCCCATCGT AACTTAAAGGGAAACTTACACAATGTCCGGAGCCCTTGACGTCCTGCAGATGAAGGAGGAGGATGTCCTC AAATTCCTTGCTGCGGGAACCCACTTAGGTGGCACCAACCTTGACTTTCAGATGGAGCAGTACATCTACA AAAGGAAAAGTGACGGTATCTACATCATAAACCTGAAGAGGACCTGGGAGAAGCTGTTGCTCGCAGCTCG AGCTATTGTTGCCATCGAGAATCCTGCTGACGTCAGCGTCATCTCCTCCAGGAACACTGGCCAGCGAGCT GTGCTGAAGTTTGCTGCTGCCACAGGAGCCACTCCGATCGCTGGCCGCTTCACACCTGGGACCTTCACTA ACCAGATCCAAGCAGCCTTCAGGGAGCCACGGCTTCTAGTGGTGACCGATCCCAGGGCTGACCATCAGCC ACTCACAGAGGCCTCTTATGTCAACCTGCCCACCATTGCTCTGTGTAACACAGATTCTCCCCTGCGCTAT GTGGACATTGCCATCCCATGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTGGCCA GGGAAGTACTCCGCATGCGAGGTACTATCTCCCGTGAGCACCCCTGGGAGGTCATGCCTGATCTTTACTT CTACAGAGACCCAGAGGAGATTGAGAAGGAGGAGCAGGCTGCTGCTGAGAAGGCTGTGACCAAGGAGGAA TTCCAGGGTGAATGGACCGCACCAGCTCCTGAGTTCACTGCTGCTCAGCCTGAGGTGGCCGACTGGTCTG AGGGTGTGCAGGTTCCCTCTGTGCCCATCCAGCAGTTCCCCACGGAAGACTGGAGTGCACAGCCAGCCAC TGAGGATTGGTCAGCAGCTCCCACAGCGCAGGCCACTGAGTGGGTTGGAGCCACCACTGAGTGGTCCTGA GCTGCTGTGCAGGTGCCTGAGCAAAGGGAAAAAAGATGGAAGGAAAATAAAGTTGCTAAAAGCTGAAAAA AAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_011029 |
| Insert Size | 888 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC055886, AAH55886 |
| RefSeq Size | 1202 bp |
| RefSeq ORF | 888 bp |
| Locus ID | 16785 |
| UniProt ID | P14206 |
| Gene Summary | Required for the assembly and/or stability of the 40S ribosomal subunit. Required for the processing of the 20S rRNA-precursor to mature 18S rRNA in a late step of the maturation of 40S ribosomal subunits. Also functions as a cell surface receptor for laminin. Plays a role in cell adhesion to the basement membrane and in the consequent activation of signaling transduction pathways. May play a role in cell fate determination and tissue morphogenesis. Also acts as a receptor for several other ligands, including the pathogenic prion protein, viruses, and bacteria. Acts as a PPP1R16B-dependent substrate of PPP1CA (By similarity). Enables malignant tumor cells to penetrate laminin tissue and vessel barriers. Activates precursor thymic anti-OFA/iLRP specific cytotoxic T-cell. May induce CD8 T-suppressor cells secreting IL-10.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR204077 | Rpsa (Myc-DDK-tagged) - Mouse ribosomal protein SA (Rpsa) |
CNY 2400.00 |
|
| MR204077L3 | Lenti ORF clone of Rpsa (Myc-DDK-tagged) - Mouse ribosomal protein SA (Rpsa) |
CNY 4750.00 |
|
| MR204077L4 | Lenti ORF clone of Rpsa (mGFP-tagged) - Mouse ribosomal protein SA (Rpsa) |
CNY 4750.00 |
