Sra1 (NM_025291) Mouse Untagged Clone
CAT#: MC203501
Sra1 (untagged) - Mouse steroid receptor RNA activator 1 (Sra1), transcript variant 1, (10ug)
CNY 2400.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AA959952; Sra; Srap; Straa1; Strra1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC048362
CGGAAGTGGAGATGGCGGAGCTGTACGTGAAGCCCGGCAACAAGGAACGCGGCTGGAACGACCCGCCACA ATTCTCCTACGGGCTCCAGACTCAGACTGGTGGACCCAAACGCACTCCCCTTACTAAGAGGGTCGCGGCC CCACAGGATGGATCCCCTAGAGCCCCAGAAACTTCTGGACCACCTCCAGTGGATCATCCACCTCCTTCAA GTAAGGCTTCCAGGCCTCCGCCCATGGGGAGCTGTCCTGCTACTGGTGTGGAGCCCCCAAGTTCCCCAGT CATTGAGTCTGAAACTCTGATAGAAGACGTGCTGAGACCTCTGGAACAGGCATTGGAGGACTGCCATGGT CACACAAAGAAACAGGTATGTGATGATATCAGCCGACGCTTGGTGCTGCTTCGAGAACAGTGGGCTGGAG GGAAGTTGTCAATACCTGTAAAGAAGAGGATGGCACTGCTAGTGCAAGAACTTTTACATCACCAGTGGGA TGCAGCAGATGACATTCACCGATCACTCATGGTTGACTATGTGACTGAGGTCAGTCAGTGGATGGTGGGA GTAAAAAGATTAATTGCAGAAAAGAGGAGTCTATCTTCAGAGGAGACCAAAGAAGAGAAATTTACAGTGG AACCTGAGAACCAGACAATACCAGGCTTCCAACAGCCATCATAATGCCTGTGGCTCCCCAGACTCACTTC ACCTGACTTCCTATGCCTTAGTGTGGAAGGCTTCTTCTTCCTTTTTACCACCAGGGAGACTATTGGTCTT GTGGGTCTTGACCAAAGATCCTATCTAGACCACTGCAAGATCACTTGTTATGTACATTTCAATAAACATC TCAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_025291 |
Insert Size | 663 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC048362, AAH48362 |
RefSeq Size | 884 bp |
RefSeq ORF | 663 bp |
Locus ID | 24068 |
UniProt ID | Q80VJ2 |
Gene Summary | Functional RNA which acts as a transcriptional coactivator that selectively enhances steroid receptor-mediated transactivation ligand-independently through a mechanism involving the modulating N-terminal domain (AF-1) of steroid receptors. Also mediates transcriptional coactivation of steroid receptors ligand-dependently through the steroid-binding domain (AF-2). Enhances cellular proliferation and differentiation and promotes apoptosis in vivo. May play a role in tumorigenesis (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (a). CCDS Note: The coding region has been updated to extend the N-terminus to one that is also supported by available conservation data. The use of an alternative upstream start codon would result in a protein that is 12 aa longer. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202517 | Sra1 (tGFP-tagged) - Mouse steroid receptor RNA activator 1 (Sra1) |
CNY 2850.00 |
|
MR202517 | Sra1 (Myc-DDK-tagged) - Mouse steroid receptor RNA activator 1 (Sra1), transcript variant 1 |
CNY 2400.00 |
|
MR202517L3 | Lenti ORF clone of Sra1 (Myc-DDK-tagged) - Mouse steroid receptor RNA activator 1 (Sra1), transcript variant 1 |
CNY 4750.00 |
|
MR202517L4 | Lenti ORF clone of Sra1 (mGFP-tagged) - Mouse steroid receptor RNA activator 1 (Sra1), transcript variant 1 |
CNY 4750.00 |