Tnfsf13 (NM_023517) Mouse Untagged Clone
CAT#: MC203367
Tnfsf13 (untagged) - Mouse tumor necrosis factor (ligand) superfamily, member 13 (Tnfsf13), transcript variant 1, (10ug)
CNY 3600.00
Cited in 1 publication. |
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2310026N09Rik; April; Tall2; Tnlg7b; Trdl1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC069900
CTTCCTAGATAATGGCACCAAATTCTCCTGAGGCTAGGGGGGAAGGAGTGTCAGAGTGTCACTAGCTCGA CCCTGGGGACAAGGGGGACTAATAGTACCCTAGCTTGATTTCTTCCTATTCTCAAGTTCCTTTTTATTTC TCCCTTGCGTAACCCGCTCTTCCCTTCTGTGCCTTTGCCTGTATTCCCACCCTCCCTGCTACCTCTTGGC CACCTCACTTCTGAGACCACAGCTGTTGGCAGGGTCCCTAGCTCATGCCAGCCTCATCTCCAGGCCACAT GGGGGGCTCAGTCAGAGAGCCAGCCCTTTCGGTTGCTCTTTGGTTGAGTTGGGGGGCAGTTCTGGGGGCT GTGACTTGTGCTGTCGCACTACTGATCCAACAGACAGAGCTGCAAAGCCTAAGGCGGGAGGTGAGCCGGC TGCAGCGGAGTGGAGGGCCTTCCCAGAAGCAGGGAGAGCGCCCATGGCAGAGCCTCTGGGAGCAGAGTCC TGATGTCCTGGAAGCCTGGAAGGATGGGGCGAAATCTCGGAGAAGGAGAGCAGTACTCACCCAGAAGCAC AAGAAGAAGCACTCAGTCCTGCATCTTGTTCCAGTTAACATTACCTCCAAGGCAGACTCTGACGTGACAG AGGTGATGTGGCAACCAGTACTTAGGCGTGGGAGAGGCCTGGAGGCCCAGGGAGACATTGTACGAGTCTG GGACACTGGAATTTATCTGCTCTATAGTCAGGTCCTGTTTCATGATGTGACTTTCACAATGGGTCAGGTG GTATCTCGGGAAGGACAAGGGAGAAGAGAAACTCTATTCCGATGTATCAGAAGTATGCCTTCTGATCCTG ACCGTGCCTACAATAGCTGCTACAGTGCAGGTGTCTTTCATTTACATCAAGGGGATATTATCACTGTCAA AATTCCACGGGCAAACGCAAAACTTAGCCTTTCTCCGCATGGAACATTCCTGGGGTTTGTGAAACTATGA TTGTTATAAAGGGGGTGGGGATTTCCCATTCCAAAAACTGGCTAGACAAAGGACAAGGAACGGTCAAGAA CAGCTCTCCATGGCTTTGCCTTGACTGTTGTTCCTCCCTTTGCCTTTCCCGCTCCCACTATCTGGGCTTT GACTCCATGGATATTAAAAAAGTAGAATATTTTGTGTTTATCTCCCAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_023517 |
Insert Size | 726 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC069900, AAH69900 |
RefSeq Size | 1185 bp |
RefSeq ORF | 726 bp |
Locus ID | 69583 |
UniProt ID | Q9D777 |
Gene Summary | Cytokine that binds to TNFRSF13B/TACI and to TNFRSF17/BCMA. Plays a role in the regulation of tumor cell growth. May be involved in monocyte/macrophage-mediated immunological processes.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
APRIL:TACI Axis is Dispensable for the Immune Response to Rabies Vaccination
,null,
Antiviral research
,PubMed ID 28619678
[Tnfsf13]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223444 | Tnfsf13 (tGFP-tagged) - Mouse tumor necrosis factor (ligand) superfamily member 13 (Tnfsf13) transcript variant 1, (10ug) |
CNY 5200.00 |
|
MR223444 | Tnfsf13 (Myc-DDK-tagged) - Mouse tumor necrosis factor (ligand) superfamily, member 13 (Tnfsf13), transcript variant 1 |
CNY 3600.00 |
|
MR223444L3 | Lenti ORF clone of Tnfsf13 (Myc-DDK-tagged) - Mouse tumor necrosis factor (ligand) superfamily, member 13 (Tnfsf13), transcript variant 1 |
CNY 5890.00 |
|
MR223444L4 | Lenti ORF clone of Tnfsf13 (mGFP-tagged) - Mouse tumor necrosis factor (ligand) superfamily, member 13 (Tnfsf13), transcript variant 1 |
CNY 5890.00 |
其它Tnfsf13产品