Coprs (NM_025556) Mouse Untagged Clone
CAT#: MC203166
Coprs (untagged) - Mouse RIKEN cDNA 2410022L05 gene (2410022L05Rik), (10ug)
CNY 2400.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1700029I03Rik; 2410022L05Rik; AA409325; AI256813; C85432; Copr5 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC029192
GCGTCCCAGGCGCCTGGCTGTGGGCGGCCGGGCATGGACCCTCAGGCAGCCACCGGTCGGGGCCCGGGCG AGCGGAGTTCGCAGGAGGCCCCCAGCGCGGAGGCTGGCTTTGCCACAGCTGACCTCTCTGGTCGGGAGAC GGAGACTGAGCTGGCCGTGGATCGACTAGCCAGTGGAGCTCAGAGCATCCCTGCTGACATTCCTGCCCAT GCCGAGGGCCCAAGTTCTGAGGAGGAAGGCTTTGCAGTGGAGAAGGAAGCTGATGGGGAGTTGTATGCCT GGGAGCTGTCAGAGGGTCCATCCTGCCCACCCATGGAACAGGCTGCAGATCTTTTTAATGAGGACTGGGA CTTGGAGCTGAAAGCAGACCAAGGAAATCCTTACGATGCTGATGACATCCAGGGGAGCATTTCCCAAGAG ATCAAGCCTTGGGTGTGCTGTGCACCACAGGGAGACATGATATACGACCCCAGTTGGCACCATCCACCTC CACTCATACCACACTACTCCAAGATGGTCTTCGAAACAGGACAGTTTGATGATGCCGAAGACTAGAAGTG TCACTTTCCACAGTGGAGTGGGGGAGTTTTTGTGTCCTCCAGATCACAAGTTGTTTCCTGTGTTTCAAGT GAGATACTCTGTCCGTTCTCAGCGACTCCTCAGTGTGGGCTATAGACAGGCATTAACTGGGGCATGTTGT TGTGGTGGTTGTTGTTAATGGACTCTGGAGTGTGTTGGAATTTTTGTCTGTGTTAGAGTTGTGTTCTTTA TAAATAAAGTTAGGGAAAAATCAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_025556 |
Insert Size | 522 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC029192, AAH29192 |
RefSeq Size | 807 bp |
RefSeq ORF | 522 bp |
Locus ID | 66423 |
UniProt ID | Q9CQ13 |
Gene Summary | Histone-binding protein required for histone H4 methyltransferase activity of PRMT5. Specifically required for histone H4 'Arg-3' methylation mediated by PRMT5, but not histone H3 'Arg-8' methylation, suggesting that it modulates the substrate specificity of PRMT5. Specifically interacts with the N-terminus of histone H4 but not with histone H3, suggesting that it acts by promoting the association between histone H4 and PRMT5. Involved in CCNE1 promoter repression (By similarity). Plays a role in muscle cell differentiation by modulating the recruitment of PRMT5 to the promoter of genes involved in the coordination between cell cycle exit and muscle differentiation.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201479 | Coprs (tGFP-tagged) - Mouse RIKEN cDNA 2410022L05 gene (2410022L05Rik) |
CNY 2850.00 |
|
MR201479 | Coprs (Myc-DDK-tagged) - Mouse RIKEN cDNA 2410022L05 gene (2410022L05Rik) |
CNY 2400.00 |
|
MR201479L3 | Lenti ORF clone of Coprs (Myc-DDK-tagged) - Mouse RIKEN cDNA 2410022L05 gene (2410022L05Rik) |
CNY 4750.00 |
|
MR201479L4 | Lenti ORF clone of Coprs (mGFP-tagged) - Mouse RIKEN cDNA 2410022L05 gene (2410022L05Rik) |
CNY 4750.00 |