Dbi (NM_007830) Mouse Untagged Clone

CAT#: MC203145

Dbi (untagged) - Mouse diazepam binding inhibitor (Dbi), transcript variant 2, (10ug)



  "NM_007830" in other vectors (3)

CNY 1200.00

CNY 2000.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms ACBD1; Acbp; endozepine; EP
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC028874
GAGCTTGCTCCCGCGCATTCGGCATCCGTATCACCTCACCAGTATGTCTCAGGCTGAATTTGACAAAGCC GCTGAGGAGGTGAAGCGCCTCAAGACTCAGCCAACTGATGAAGAGATGCTGTTCATCTACAGTCACTTCA AACAAGCTACCGTGGGCGATGTAAATACAGATCGGCCGGGGCTCTTGGACCTCAAGGGCAAAGCCAAGTG GGACTCGTGGAACAAGCTGAAAGGGACTTCCAAGGAAAGTGCCATGAAGACCTATGTGGAAAAGGTAGAC GAGCTAAAGAAGAAATACGGAATATAAATCACCAGATTTGGTGGCCAGCCACACGTGTGACCTGTGAGGA CATAATGCCTTGGTTTTTTCTAATGTAGATGATATGGCTGTGATACATTAGGGCCAGCGTTAACCTCTGC TCCTCCTCCCTCTGTAGTTTTTACCTACAATCAATTAAAAGTACATTTGTTACTCTGAAAAAAAAAAAAA AAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_007830
Insert Size 264 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC028874, AAH28874
RefSeq Size 500 bp
RefSeq ORF 264 bp
Locus ID 13167
UniProt ID P31786
Gene Summary Binds medium- and long-chain acyl-CoA esters with very high affinity and may function as an intracellular carrier of acyl-CoA esters. It is also able to displace diazepam from the benzodiazepine (BZD) recognition site located on the GABA type A receptor. It is therefore possible that this protein also acts as a neuropeptide to modulate the action of the GABA receptor.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) has an alternate 5' exon, as compared to variant 1. The resulting isoform (2) is shorter and has a different N-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...