Rpl35a (NM_021338) Mouse Untagged Clone
CAT#: MC202881
Rpl35a (untagged) - Mouse ribosomal protein L35A (Rpl35a), transcript variant 1, (10ug)
CNY 1200.00
CNY 2000.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2810431L15Rik; Rpl35 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC027223 sequence for NM_021338
CGATTGCTGGGGTGCGTTTAGTTTCATCCCTCACCGAGACAACCTGGCGTCTCGGAGAACCCGACCGCCA GAGGCCTGCTGGGAACAGGACTTCTAACAGCAAGTATGTCTGGAAGGCTGTGGTGCAAGGCCATTTTTGC TGGCTACAAGCGAGGTCTCCGGAACCAAAGAGAGCACACGGCTCTTCTTAAAATTGAAGGCGTTTATGCC CGAGATGAAACGGAGTTCTACTTAGGCAAGAGATGTGCTTATGTGTATAAGGCAAAAAACAATACAGTGA CTCCTGGAGGTAAACCAAACAAAACCAGAGTGATCTGGGGAAAGGTAACTCGGGCCCACGGAAACAGCGG TATGGTTCGTGCCAAATTCCGAAGCAACCTTCCTGCAAAGGCCATTGGACACAGAATCCGTGTGATGCTG TACCCATCCCGGATTTAAACTAATGGAGAGTAAATAAATAAAAGTAGATTTGTGCTCTGTAAAAAAAAAA AAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_021338 |
Insert Size | 333 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC027223, AAH27223 |
RefSeq Size | 505 bp |
RefSeq ORF | 333 bp |
Locus ID | 57808 |
UniProt ID | O55142 |
Gene Summary | Required for the proliferation and viability of hematopoietic cells. Plays a role in 60S ribosomal subunit formation. The protein was found to bind to both initiator and elongator tRNAs and consequently was assigned to the P site or P and A site.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200413 | Rpl35a (tGFP-tagged) - Mouse ribosomal protein L35a (Rpl35a) |
CNY 2850.00 |
|
MG219969 | Rpl35a (tGFP-tagged) - Mouse ribosomal protein L35A (Rpl35a) transcript variant 1, (10ug) |
CNY 2850.00 |
|
MR219969 | Rpl35a (Myc-DDK-tagged) - Mouse ribosomal protein L35A (Rpl35a), transcript variant 1 |
CNY 1200.00 |
|
MR219969L3 | Lenti ORF clone of Rpl35a (Myc-DDK-tagged) - Mouse ribosomal protein L35A (Rpl35a), transcript variant 1 |
CNY 4750.00 |
|
MR219969L4 | Lenti ORF clone of Rpl35a (mGFP-tagged) - Mouse ribosomal protein L35A (Rpl35a), transcript variant 1 |
CNY 4750.00 |