Gabarapl2 (NM_026693) Mouse Untagged Clone
CAT#: MC202843
Gabarapl2 (untagged) - Mouse gamma-aminobutyric acid (GABA) A receptor-associated protein-like 2 (Gabarapl2), (10ug)
CNY 1200.00
CNY 2000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 0610012F20Rik; 2900019O08Rik; AI173605; GATE-16; Gef2 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC026798 sequence for NM_026693
CCCGCCTCCGTTGTTGTTGTGGTCGCTTCGCCGAAGTCCGCGGCTCGAAGAGCCGGCTCCGTCGCTTCCC GTCGCCATGAAGTGGATGTTTAAGGAGGACCACTCTCTGGAACACAGATGCGTGGAATCCGCGAAGATCA GAGCGAAGTACCCCGACCGAGTTCCGGTGATCGTGGAAAAAGTCTCGGGCTCTCAGATTGTTGACATAGA CAAGAGGAAGTACTTGGTCCCCTCGGACATCACTGTGGCTCAGTTCATGTGGATCATCAGGAAAAGGATC CAGCTTCCCTCCGAGAAGGCCATCTTCCTGTTTGTGGACAAGACAGTCCCACAGTCCAGCCTAACTATGG GACAGCTTTACGAGAAGGAAAAAGATGAAGATGGATTCTTGTATGTGGCCTACAGCGGAGAGAACACTTT TGGCTTCTGAGGCCCTTGCTGGGCTAGGTGCGCCCTTCCTGCTTGTGTCTCTTGTAAATAACTGGCTGTT CTCAGTTACTCTGCCAGAGCCTCCACACAGACCTACTAGTGCATTTGTAACTGGATTTATTTCTTAATAT ATTGGAAGGTTTTGTTTCCTTAGATTAGTAAATTATCATACAGAGTTTTATTTTCAGTTTTCTTTTTGTG CACTGTCCTCATGGCTATTTGCTCCAGGGAACCTGTCCTCTGGGAATCATATTTAATGAAGATATTTCCG TAATGAAGGGAGGTAGGTGTGGTGGTAAAGGGAAAAGGAGGGGCTGATGCATAGTTCTGGATTATGTTGA AAGTGTTAGATGGCTAAGTATTAAAAGCACCCAGATTAAATCCTTAGCAATCAGAACACTTGCTTCACTA GATTTTGCCAACTGCAAATCATGTTGGACTGAGCTAATCTATTCTTCTTTCTGAGACTATTAAGGTAAAT AATTAACAATAAAGCCTCCTTATAAAGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_026693 |
| Insert Size | 354 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC026798, AAH26798 |
| RefSeq Size | 976 bp |
| RefSeq ORF | 354 bp |
| Locus ID | 93739 |
| UniProt ID | P60521 |
| Gene Summary | Ubiquitin-like modifier involved in intra-Golgi traffic. Modulates intra-Golgi transport through coupling between NSF activity and SNAREs activation. It first stimulates the ATPase activity of NSF which in turn stimulates the association with GOSR1 (By similarity). Involved in autophagy. Plays a role in mitophagy which contributes to regulate mitochondrial quantity and quality by eliminating the mitochondria to a basal level to fulfill cellular energy requirements and preventing excess ROS production. Whereas LC3s are involved in elongation of the phagophore membrane, the GABARAP/GATE-16 subfamily is essential for a later stage in autophagosome maturation.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200526 | Gabarapl2 (tGFP-tagged) - Mouse gamma-aminobutyric acid (GABA-A) receptor-associated protein-like 2 (Gabarapl2) |
CNY 3420.00 |
|
| MG215820 | Gabarapl2 (tGFP-tagged) - Mouse gamma-aminobutyric acid (GABA) A receptor-associated protein-like 2 (Gabarapl2), (10ug) |
CNY 2090.00 |
|
| MR215820 | Gabarapl2 (Myc-DDK-tagged) - Mouse gamma-aminobutyric acid (GABA) A receptor-associated protein-like 2 (Gabarapl2) |
CNY 1200.00 |
|
| MR215820L3 | Lenti ORF clone of Gabarapl2 (Myc-DDK-tagged) - Mouse gamma-aminobutyric acid (GABA) A receptor-associated protein-like 2 (Gabarapl2) |
CNY 3800.00 |
|
| MR215820L4 | Lenti ORF clone of Gabarapl2 (mGFP-tagged) - Mouse gamma-aminobutyric acid (GABA) A receptor-associated protein-like 2 (Gabarapl2) |
CNY 3800.00 |
其它Gabarapl2产品
