Cln3 (NM_009907) Mouse Untagged Clone
CAT#: MC202788
Cln3 (untagged) - Mouse ceroid lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease) (Cln3), transcript variant 2, (10ug)
CNY 5488.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI323623; batt |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC080759 sequence for NM_009907
GTCTACCTTGCGGAGAGTTCAGCTGCTCTTAAAGCTCGGAACACACGCTGACTTTGGGCCCTTTGGGGGA CCCGAACTCAATGTTATGGGAAGTTCTGCGGGCTCGTGGAGGCGCCTTGAGGATTCTGAGAGGGAGGAGA CCGACTCAGAGCCCCAGGCCCCTCGGTTGGATAGTCGGAGTGTCCTTTGGAAGAATGCAGTGGGTTTCTG GATCTTGGGTCTTTGCAACAATTTCTCATATGTGGTGATGCTGAGCGCTGCCCATGACATCCTCAAGCAG GAGCAGGCGTCTGGAAACCAGAGCCATGTAGAACCAGGCCCAACACCCACACCCCACAACAGCTCATCTC GATTTGACTGCAACTCCATCTCCACAGCTGCGGTGCTCCTAGCAGACATCCTTCCCACCCTTGTCATCAA ACTCCTGGCGCCTCTTGGCCTTCACTTGCTGCCTTACAGCCCCCGGGTGCTCGTCAGTGGAGTTTGTTCT GCTGGGAGCTTTGTTCTGGTTGCCTTCTCTCAGTCAGTGGGGTTAAGCCTGTGTGGAGTGGTTTTGGCCA GCATCTCCTCAGGGCTAGGGGAGGTCACCTTCCTCTCACTGACTGCCTTCTACCCCAGTGCTGTGATCTC ATGGTGGTCTTCGGGTACCGGGGGTGCAGGGCTTCTTGGATCGCTGTCTTACCTGGGACTCACCCAGGCT GGCCTCTCCCCGCAGCACACCCTACTTTCTATGTTGGGGATCCCTGTTCTGCTGCTAGCCAGCTATTTCT TGTTGCTCACGTCTCCTGAACCCCTGGACCCTGGAGGGGAAAACGAGGCAGAGACTGCTGCCCGGCAGCC TCTCATAGGCACCGAGACCCCAGAGTCAAAGCCAGGTGCCAGCTGGGACCTCTCCCTCCAGGAAAGGTGG ACAGTGTTCAAGGGTCTCTTGTGGTACATCATCCCTCTGGTGCTGGTCTACTTTGCAGAATACTTTATCA ACCAGGGACTTTTCGAGCTCCTGTTTTTCCGGAACACTTCCCTAAGCCATGCTCAGCAGTACCGATGGTA CCAGATGCTATACCAGGCTGGTGTGTTCGCCTCCCGCTCTTCTCTCCAATGTTGCCGAATACGGTTCACC TGGGTCCTAGCCCTGCTCCAGTGCCTCAACCTGGCCCTCCTGCTGGCAGATGTCTGCTTGAACTTCTTGC CCAGCATCTACCTCATCTTCATCATCATTCTGTACGAAGGGCTCCTGGGTGGGGCCGCTTACGTGAATAC CTTCCACAACATTGCTCTGGAGACCAGTGACAAGCACCGAGAGTTTGCCATGGAAGCTGCCTGTATCTCT GACACCTTGGGAATCTCCCTGTCGGGGGTCCTGGCCCTGCCTCTGCATGACTTCCTCTGTCACCTCCCTT GACAGGAGTTGCTCGACACACACTGATCTGCAGGCACATGAGCAGATCACACATCTTCGAGCTCTGCCAC AGCCTTTCCCTGCCCCACTGCAGCAAGGAGCCCCTGATGTTTCCCACTCCTGAGCTGGCCTCAGAGTTTT CTCCTACCCTCTGCCCTTCTAATAAATGCTTATTTTAACAGTTAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_009907 |
Insert Size | 1317 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC080759, AAH80759 |
RefSeq Size | 1601 bp |
RefSeq ORF | 1317 bp |
Locus ID | 12752 |
UniProt ID | Q61124 |
Gene Summary | This gene encodes a transmembrane protein called battenin that is involved in lysosomal function. Mutations in this, as well as other neuronal ceroid-lipofuscinosis genes, cause a number of neurodegenerative diseases collectively known as neuronal ceroid lipofuscinoses, the most common of which is juvenile neuronal ceroid-lipofuscinosis (Batten disease). Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG206982 | Cln3 (tGFP-tagged) - Mouse ceroid lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease) (Cln3) |
CNY 7088.00 |
|
MG227238 | Cln3 (tGFP-tagged) - Mouse ceroid lipofuscinosis neuronal 3 juvenile (Batten Spielmeyer-Vogt disease) (Cln3) transcript variant 2, (10ug) |
CNY 3710.00 |
|
MR227238 | Cln3 (Myc-DDK-tagged) - Mouse ceroid lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease) (Cln3), transcript variant 2 |
CNY 5488.00 |
|
MR227238L3 | Lenti ORF clone of Cln3 (Myc-DDK-tagged) - Mouse ceroid lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease) (Cln3), transcript variant 2 |
CNY 5230.00 |
|
MR227238L4 | Lenti ORF clone of Cln3 (mGFP-tagged) - Mouse ceroid lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease) (Cln3), transcript variant 2 |
CNY 5230.00 |