Tmed10 (NM_026775) Mouse Untagged Clone

CAT#: MC202755

Tmed10 (untagged) - Mouse transmembrane emp24-like trafficking protein 10 (yeast) (Tmed10), (10ug)



  "NM_026775" in other vectors (4)

CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1110014C03Rik; p23; p24delta1; Tmp21
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC085097 sequence for NM_026775
GGCCCCGGGTGGTGAACGAGGCTCCGGCACCATGTCTGGTTTGTTTGGCCCACTCTCCCGGCCTGGCCCT CTCCCGTCCGCCTGGCTCTTTCTGTTGCTGCTCGGCCCCAGCTCGGTCCTCGGCATCTCCTTCCATCTGC CCGTGAACTCTCGCAAGTGTCTCCGAGAGGAGATCCACAAGGACCTGCTGGTGACGGGCGCCTACGAGAT CACCGACCAGTCTGGGGGCGCTGGCGGCCTGCGCACCCACCTCAAGATCACAGATTCTGCTGGCCATATT CTGTATGCCAAAGAGGATGCAACCAAGGGGAAGTTTGCCTTTACCACGGAAGACTATGACATGTTTGAAG TGTGTTTTGAGAGCAAGGGAACAGGGCGGATACCTGACCAACTCGTGATTCTAGACATGAAGCATGGAGT AGAGGCGAAAAATTATGAAGAGATTGCAAAAGTCGAGAAACTCAAACCACTGGAGGTGGAGTTACGACGG CTCGAGGACCTTTCCGAGTCCATTGTTAATGACTTTGCCTACATGAAGAAGCGGGAAGAGGAGATGAGGG ACACTAATGAGTCCACGAACACCCGGGTCCTGTACTTCAGCATCTTTTCCATGTTCTGCCTCATTGGACT AGCCACCTGGCAGGTCTTCTACCTGCGTCGCTTCTTCAAGGCCAAGAAGTTGATAGAGTAATGAGGCTCA GTGTTCTGTCCCCTAGAGCCAGCAGAACATCGCTGGGACATGCCTGGCCTAGCCCAAGGCCATTCTACTA ACAGTACCATCAAGGCACAGCTGAGCTTTCTTGCCAGAACTGATACTTTTGGTATGAGAGCACATGGGCA CCACCTATACCCAACAAGTCAATGAGGACTTTAATGCAGTAGGATTTGGACTGGTTTTGCAACAAGATTA TTAAAGTCGCCTATGGAAAGAAAACAAAATAAAACAAAACAACAAACCGGGGTTACCTAGATAACGCCAA AGCCAGCCTTCGTCCTGGGTCGCCCGCCTCACAGGATCTGTTTGAGCTGTTTGCTTTTTCTCTCCCACCT GCTCATCGCCTTGTCCTTCACTCTAGTTCTCCTCCCAAGATTTCTCTGACTGCGGTCAGCTCTTTCATAT CAGTTGTCTCTTTGGTTTCCTTGTGAAAACACCTTGAACTTCTCTTGGTCCTTAGATGAAATGTTTACAT AGCTTCTGGTGATATCCTTCATAATTTTATGTCTCCTAAAAGGGTCATGGGTGGGACACATTAAAAGGTG AGCTTTGAACTGTAGATAATCTCTTAAAAAAATCTCATTTTAGACCATTAAAATGTTTGTGCTCAAAAAA AAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_026775
Insert Size 660 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC085097, AAH85097
RefSeq Size 1339 bp
RefSeq ORF 660 bp
Locus ID 68581
UniProt ID Q9D1D4
Gene Summary Involved in vesicular protein trafficking. Mainly functions in the early secretory pathway. Thought to act as cargo receptor at the lumenal side for incorporation of secretory cargo molecules into transport vesicles and to be involved in vesicle coat formation at the cytoplasmic side. In COPII vesicle-mediated anterograde transport involved in the transport of GPI-anchored proteins and proposed to act together with TMED2 as their cargo receptor; the function specifically implies SEC24C and SEC24D of the COPII vesicle coat and lipid raft-like microdomains of the ER. Recognizes GPI anchors structural remodeled in the ER by PGAP1 and MPPE1. In COPI vesicle-mediated retrograde transport involved in the biogenesis of COPI vesicles and vesicle coat recruitment. On Golgi membranes, acts as primary receptor for ARF1-GDP which is involved in COPI-vesicle formation. Increases coatomer-dependent GTPase-activating activity of ARFGAP2. Involved in trafficking of G protein-coupled receptors (GPCRs). Regulates F2LR1, OPRM1 and P2RY4 exocytic trafficking from the Golgi to the plasma membrane thus contributing to receptor resensitization. Involved in trafficking of amyloid beta A4 protein and soluble APP-beta release (independent of modulation of gamma-secretase activity). As part of the presenilin-dependent gamma-secretase complex regulates gamma-cleavages of the amyloid beta A4 protein to yield amyloid-beta 40 (Abeta40). Involved in organization of the Golgi apparatus (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...