Slc3a2 (NM_008577) Mouse Untagged Clone

CAT#: MC202720

Slc3a2 (untagged) - Mouse solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 (Slc3a2), transcript variant 2, (10ug)



  "NM_008577" in other vectors (4)

CNY 3928.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Recombinant Anti-CD98 (Clone RL388)
    • 200 ug

CNY 7170.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 4F2; 4F2HC; AI314110; Cd98; Ly-10; Ly-m10; Ly10; Mdu1; Mgp-2hc; NACAE
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC065173 sequence for NM_008577
GCTCTGCTAGCCTCACGGCCACGGGACGCCTCTCTGAACGGGGATCCAGGCAGGATTAGAGCTGCCTCAC TGACTACAGGCCGTGTCGTGTCACCGTTTCTGCAGGCACCATGAGCCAGGACACCGAAGTGGACATGAAA GATGTGGAGCTGAACGAGCTAGAACCGGAGAAGCAGCCCATGAATGCAGCGGACGGGGCGGCGGCCGGGG AGAAGAACGGTCTGGTGAAGATCAAGGTGGCGGAGGACGAGACGGAGGCCGGGGTCAAGTTCACCGGCTT ATCCAAGGAGGAGCTACTGAAGGTAGCGGGCAGCCCTGGCTGGGTGCGCACCCGCTGGGCGCTGCTGCTG CTCTTCTGGCTCGGTTGGCTGGGCATGCTGGCGGGCGCCGTGGTTATCATCGTTCGGGCGCCGCGCTGCC GTGAGCTGCCTGTACAGAGGTGGTGGCACAAGGGCGCCCTCTACCGCATCGGCGACCTTCAGGCCTTTGT AGGCCGGGATGCGGGAGGCATAGCTGGTCTGAAGAGCCATCTGGAGTACTTGAGCACCCTGAAGGTGAAG GGCCTGGTGTTAGGCCCAATTCACAAGAACCAGAAGGATGAAATCAATGAAACCGACCTGAAACAGATTA ATCCCACTTTGGGCTCCCAGGAAGATTTTAAAGACCTTCTACAAAGTGCCAAGAAAAAGAGCATTCACAT CATTTTGGACCTCACTCCCAACTACCAGGGCCAGAATGCGTGGTTCCTCCCTGCTCAGGCTGACATTGTA GCCACCAAAATGAAGGAAGCTCTGAGTTCTTGGTTGCAGGACGGTGTGGATGGTTTCCAATTCCGGGATG TGGGAAAGCTGATGAATGCACCCTTGTACTTGGCTGAGTGGCAGAATATCACCAAGAACTTAAGTGAGGA CAGGCTTTTGATTGCAGGGACTGAGTCCTCTGACCTGCAGCAAATTGTCAACATACTTGAATCCACCAGC GACCTGCTGTTGACCAGCTCCTACCTGTCAAATTCCACTTTCACTGGGGAGCGTACTGAATCCCTAGTCA CTAGGTTTTTGAATGCCACTGGCAGCCAATGGTGCAGCTGGAGTGTGTCGCAAGCAGGACTCCTCGCAGA CTTTATACCGGACCATCTTCTCCGACTCTACCAGCTGCTGCTCTTCACTCTGCCAGGGACTCCTGTTTTT AGCTACGGGGATGAGCTTGGCCTTCAGGGTGCCCTTCCTGGACAGCCTGCGAAGGCCCCACTCATGCCGT GGAATGAGTCCAGCATCTTTCACATCCCAAGACCTGTAAGCCTCAACATGACAGTGAAGGGCCAGAATGA AGACCCTGGCTCCCTCCTTACCCAGTTCCGGCGGCTGAGTGACCTTCGGGGTAAGGAGCGCTCTCTGTTG CACGGTGACTTCCATGCACTGTCTTCCTCACCTGACCTCTTCTCCTACATACGACACTGGGACCAGAATG AGCGTTACCTGGTGGTGCTCAACTTCCGAGATTCGGGCCGGTCAGCCAGGCTAGGGGCCTCCAACCTCCC TGCTGGCATAAGCCTGCCAGCCAGCGCTAAACTTTTGCTTAGTACCGACAGTGCCCGGCAAAGCCGTGAG GAGGACACCTCCCTGAAGCTGGAAAACCTGAGCCTGAATCCTTATGAGGGCTTGCTGTTACAGTTCCCCT TTGTGGCCTGATCCTTCCTATGCAGAACCTACCACCCTCCTTTGTTCTCCCCAGGCCTTTTGGATTCTAG TCTTCCTCTCCTTGTTTTTAAACTTTTGCAGATTACATACGAATTCTTATACTGGGTGTTTTTGTCTTCA AATAAAAACATCACCCCTGCCTCATGAAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
ACCN NM_008577
Insert Size 1581 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC065173, AAH65173
RefSeq Size 1866 bp
RefSeq ORF 1581 bp
Locus ID 17254
UniProt ID P10852
Gene Summary Component of several heterodimeric amino acid transporter complexes. The precise substrate specificity depends on the other subunit in the heterodimer (PubMed:9915839). The heterodimer with SLC3A2 functions as sodium-independent, high-affinity transporter that mediates uptake of large neutral amino acids such as phenylalanine, tyrosine, L-DOPA, leucine, histidine, methionine and tryptophan (PubMed:9915839). The complexes with SLC7A6 and SLC7A7 mediate uptake of dibasic amino acids. The complexes function as amino acid exchangers (By similarity). Required for targeting of SLC7A5 and SLC7A8 to the plasma membrane and for channel activity (PubMed:9915839). Plays a role in nitric oxide synthesis in human umbilical vein endothelial cells (HUVECs) via transport of L-arginine (By similarity). The heterodimer with SLC7A5/LAT1 may play a role in the transport of L-DOPA across the blood-brain barrier (Probable). May mediate blood-to-retina L-leucine transport across the inner blood-retinal barrier (By similarity). The heterodimer with SLC7A5/LAT1 can mediate the transport of thyroid hormones triiodothyronine (T3) and thyroxine (T4) across the cell membrane. When associated with SLC7A5 or SLC7A8, involved in the cellular activity of small molecular weight nitrosothiols, via the stereoselective transport of L-nitrosocysteine (L-CNSO) across the transmembrane. The heterodimer with SLC7A5 is involved in the uptake of toxic methylmercury (MeHg) when administered as the L-cysteine or D,L-homocysteine complexes. Together with ICAM1, regulates the transport activity SLC7A8 in polarized intestinal cells, by generating and delivering intracellular signals. When associated with LAPTM4B, the heterodimer formed by SLC3A2 and SLC7A5 is recruited to lysosomes to promote leucine uptake into these organelles, and thereby mediates mTORC1 activation (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' coding region and 5' UTR, compared to variant 1. This results in a shorter and distinct N-terminus in isoform b, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...