Selenow (NM_009156) Mouse Untagged Clone

Specifications

Product Data
Type	Mouse Untagged Clone
Synonyms	selW; Sep; Sepw1
Vector	PCMV6-Kan/Neo
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >BC052719 sequence for NM_009156 CTTGTTGCTTGTGGGTCGGGTCCTCGTGTTGTGCGGGGATGCGACGTGCAGCTATGGCGCTCGCCGTTCG AGTCGTGTATTGTGGAGCTTGAGGCTATAAGCCCAAGTACCTCCAGCTCAAGGAGAAGCTAGAACATGAG TTCCCCGGATGCCTGGACATTTGTGGCGAGGGGACTCCCCAGGTCACCGGGTTCTTTGAAGTGACAGTAG CCGGGAAGTTGGTCCACTCCAAGAAGAGAGGTGATGGCTATGTGGATACAGAGAGCAAGTTCCGGAAACT GGTGACCGCCATCAAAGCTGCCTTGGCTCAGTGCCAGTGAGCCCTAGAGGCAGGGTCCTGAAAGCTCCTG GCCGGCCTTCCTTGGCAGCCGCTTCATGACAGGAAGGACTGAAATGTCTTAGACCTGTGGTCTTTCCTCG ATGTTCCTGCGGCCACCAAGTCAGGCCAGAGATGGATTCTGGCTGTGGGTGCCTCCCCAGAATCTACCCG TGCACGCAGCCTGCCCTGCCCCCCTGCCCTCTTCCCCACCTCTCTCTCTGAATTCCCCCATTGTTTCCCA CCCACCCTCCTGCTTTGCTTTCCCTTTCCACCTCAAGACTTCAAGAAGACAGGCAGCCATGTTTCCAGGT GTTCCCGGTTGAATAAAGTTTGGATGAGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites	AscI-NotI
ACCN	NM_009156
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
OTI Annotation	This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	BC052719, AAH52719
RefSeq Size	690 bp
Locus ID	20364
UniProt ID	P63300
Gene Summary	This gene encodes a selenoprotein containing a selenocysteine (Sec) residue, which is encoded by the UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, the Sec insertion sequence (SECIS) element that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. This protein is highly expressed in skeletal muscle and brain. It belongs to the SelWTH family, which possesses a thioredoxin-like fold and a conserved CxxU (C is cysteine, U is Sec) motif, and has been shown to function as a glutathione-dependent antioxidant in vivo. Studies in mouse suggest that this selenoprotein is involved in muscle growth and differentiation, and in the protection of neurons from oxidative stress during neuronal development. [provided by RefSeq, Apr 2017]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.