Psmg3 (NM_025604) Mouse Untagged Clone
CAT#: MC202664
Psmg3 (untagged) - Mouse proteasome (prosome, macropain) assembly chaperone 3 (Psmg3), (10ug)
CNY 1200.00
CNY 2000.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1810042K04Rik; 4930403H09Rik; AI303239 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC058692 sequence for NM_025604
GCTTTCTGGCGCTGCTGGTGGGGTGAGCGCTGGTTGCCGAGGGTTTCGGTCCCAACTGCTGTCAGTAGTG ATCCAGCCACCCCAGTCCTGCGCCGTCGGGGCTCCCCGCCTCCGCTGAAGAACGGGACCATGGAAGACAA ACCACTGGTAGTATCTAAACAGAAGACAGAAGTGGTGTGCGGTGTGCCCACCCAGGTGGTCTGCACGGCC TTCAGCAGCCACATCCTAGTTGTGGTGACCCAGTTCGGGAAGATGGGTACGCTAGTGTCCTTGGAGCCCA GCAATGTGGCCAATGACATCAGCAAGCCAGTGCTCACCACGAGAGTCCTCCTCGGGCAGGACGAGCCTCT CATCCATGTCTTTGCAAAGAACCTGGTAGCATTTGTGTCGCAAGAAGCAGGAAACAGAGCCGTCCTGCTG GCCATGGCTGTGAAAGACAAGAGCATGGAGAGGCTCAAGGCATTGAAGGAAGTGATCCGGCTGTGCCAGG TGTGGTGACCTGCCGTTAGCAGTGCCAGACACAGACGTATGGACGCTCGGTGAGCGGGGCCTTTGAGACC CATCTTTCCAGCGCCAGGAGAGAGCTCATTCCAGGGCCTTTAGTCCTCAAAGCTGGAAACAGCACTCAAG TCTCAGGGACTCTCCCTGCGTGGCTACTGTGTTCTGCCTTGGGCACTGGAGCGGGGCTGGGCTGCAGCAG CTGCATCCACTGAGTGGAAATGAGCGGCCGGTTATGAGGACAAGTAATCCTGGGTGTGCAGGAGCACTTG TGGGAAGATTTTTTTATTAAAAATAAATCTAAAGTAAAAAAAAAAAAAAAAAA |
Restriction Sites | AscI-NotI |
ACCN | NM_025604 |
Insert Size | 369 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC058692, AAH58692 |
RefSeq Size | 823 bp |
RefSeq ORF | 369 bp |
Locus ID | 66506 |
UniProt ID | Q9CZH3 |
Gene Summary | Chaperone protein which promotes assembly of the 20S proteasome. May cooperate with PSMG1-PSMG2 heterodimers to orchestrate the correct assembly of proteasomes.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 both encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200607 | Psmg3 (tGFP-tagged) - Mouse RIKEN cDNA 1810042K04 gene (1810042K04Rik) |
CNY 2850.00 |
|
MR200607 | Psmg3 (Myc-DDK-tagged) - Mouse proteasome (prosome, macropain) assembly chaperone 3 (Psmg3) |
CNY 1200.00 |
|
MR200607L3 | Lenti ORF clone of Psmg3 (Myc-DDK-tagged) - Mouse proteasome (prosome, macropain) assembly chaperone 3 (Psmg3) |
CNY 4750.00 |
|
MR200607L4 | Lenti ORF clone of Psmg3 (mGFP-tagged) - Mouse proteasome (prosome, macropain) assembly chaperone 3 (Psmg3) |
CNY 4750.00 |