Marveld2 (NM_178410) Mouse Untagged Clone
CAT#: MC202301
Marveld2 (untagged) - Mouse MARVEL (membrane-associating) domain containing 2 (Marveld2), transcript variant 2, (10ug)
CNY 1200.00
CNY 2000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | BC003296; MARVD2; Mrvldc2; Tric; Trica; Tricb; Tricc |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC132356 sequence for NM_178410
TGTGTGAAGCTGCCATCAGTGATCGACAGAGGGATCAGGAAGTTAATGTCAAAGACTTGAGAACAACAAC TAAAATGACTCCTGAGCTGTTGAGTGGGCACATCCCTCCCGGCCACATTCCGAAGCCTATCGTGATGCCT GACTACGTGGCAAAATATCCTGTGATTCAGACAGATGACGATCGAGAACGCTATAAGGCTGTGTTCCAAG ACCAGTTTTCAGAGTACAAAGAGCTGTCTGCGGAAGTGCAGGCCATCCTGAGGAAGTTTGACGAGCTGGA CACAGTGATGAGCAGGCTCCCACATCATTCTGAAAACCGCCAGGAACACGAGAGAATTTCAAGAATTCAT GAAGAGTTTAGGAAAAAGAAGAATGACCCTTCGTTTCTGGAAAAAAAGGAGCGTTGCGATTACCTCAAGA ACAAACTCTCTCACATAAAGCAAAGAATTCAAGAATACGATAAAGTGATGAATTGGGATACGCAAGGTTA TCCCTAGACACTGTTTAGCCGCTGCTGCTGTGTGCTGGTCTCCTGGGTGAGCAGCAGGCACCTCCAGGTC ATCTTCCGCTTGGTTGAAGCACAT |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_178410 |
| Insert Size | 423 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC132356, AAI32357 |
| RefSeq Size | 584 bp |
| RefSeq ORF | 423 bp |
| Locus ID | 218518 |
| Gene Summary | Plays a role in the formation of tricellular tight junctions and of epithelial barriers (PubMed:16365161). Required for normal hearing via its role in the separation of the endolymphatic and perilymphatic spaces of the organ of Corti in the inner ear, and for normal survival of hair cells in the organ of Corti (PubMed:26677943).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG225365 | Marveld2 (tGFP-tagged) - Mouse MARVEL (membrane-associating) domain containing 2 (Marveld2) transcript variant 2, (10ug) |
CNY 3040.00 |
|
| MR225365 | Marveld2 (Myc-DDK-tagged) - Mouse MARVEL (membrane-associating) domain containing 2 (Marveld2), transcript variant 2 |
CNY 2760.00 |
|
| MR225365L3 | Lenti ORF clone of Marveld2 (Myc-DDK-tagged) - Mouse MARVEL (membrane-associating) domain containing 2 (Marveld2), transcript variant 2 |
CNY 4660.00 |
|
| MR225365L4 | Lenti ORF clone of Marveld2 (mGFP-tagged) - Mouse MARVEL (membrane-associating) domain containing 2 (Marveld2), transcript variant 2 |
CNY 4660.00 |
其它Marveld2产品
