Ndufb10 (NM_026684) Mouse Untagged Clone
CAT#: MC202225
Ndufb10 (untagged) - Mouse NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10 (Ndufb10), nuclear gene encoding mitochondrial protein, (10ug)
CNY 2400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 22kDa; 0610011B04Rik; PDSW |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC031664 sequence for NM_026684
GCGGATACGGACGTGGAGCGAGTAGAAGGTCGGTGGGGAGAGTTTGCTTAAGCCATGCCAGATTCTTGGG ACAAGGATGTGTACCCGGAGCCCCCGAGCCGCACGCCTGCTCCCTCGCCGCAGACCTCGCTCCCTAACCC CATCACCTACTTGACGAAGGCCTACGACCTCGTCGTGGACTGGCCCGTGACCCTCGTGAGAGAGTTTATT GAACGACAGCATGCCAAGAACCGAACCTACTACTACCACCGACAGTACCGTCGAGTGCCAGACATCACAG AATGCAAAGAGGGTGATGTTCTGTGTATCTATGAGGCTGAGATGCAGTGGAGAAGGGACTTCAAAGTTGA CCAGGAGATCATGAACATCATCCAGGAGAGACTGAAGGCTTGTCAGCAGAGGGAGGGAGAGAACTACCAG CAGAACTGTGCCAAGGAACTGGAGCAGTTCACCAAAGTGACTAAAGCCTACCAGGACCGCTACTTGGACC TGGGAGCCTATTATTCTGCCAGAAAGTGTCTGGCAAAGCAGAAGCAGAGAATGCTGGAAGAAAGGAAGGC TGCGAGGCAGGAGGCTGCTGCCTAGGTGACCAGAACTCTTCATTCCACTGCTAAAAATAAAGTCAAGAGT TTTGGCTTAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_026684 |
| Insert Size | 531 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC031664, AAH31664 |
| RefSeq Size | 660 bp |
| RefSeq ORF | 531 bp |
| Locus ID | 68342 |
| UniProt ID | Q9DCS9 |
| Gene Summary | Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201544 | Ndufb10 (tGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10 (Ndufb10) |
CNY 2850.00 |
|
| MR201544 | Ndufb10 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10 (Ndufb10), nuclear gene encoding mitochondrial protein |
CNY 2400.00 |
|
| MR201544L3 | Lenti ORF clone of Ndufb10 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10 (Ndufb10), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |
|
| MR201544L4 | Lenti ORF clone of Ndufb10 (mGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10 (Ndufb10), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |
其它Ndufb10产品
