Plgrkt (NM_026362) Mouse Untagged Clone

CAT#: MC202175

Plgrkt (untagged) - Mouse RIKEN cDNA 5033414D02 gene (5033414D02Rik), (10ug)



  "NM_026362" in other vectors (4)

CNY 1200.00

CNY 2000.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1110007H22Rik; 5033414D02Rik; AI852040; Plg-R(KT); Plg-RKT
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC024953 sequence for NM_026362
CTCTGCTGCGGTCACCGTCCCCGCACCGTGTCGCGTGAGATCTCCAGAGGGACACTCCTGTTTGCCTTCT ATATTTAACCGTGTACCTGAGATTTCCCCCGACACATCCAAAGTCCAAGTCCAAGAGAGCAAGGCCCAGA AGGAGGTCAAGATGGGGTTTATATTCTCGAAATCTATGAACGAAAACATGAAAAACCAACAGGAGTTCAT GGTTACGCATGCTCGGCTTCAGCTGGAAAGGCATCTGACCATGCAGAATGAGATGAGAGAAAGGCAAATG GCTATGCAGATCGCCTGGTCTCGGGAATTCCTCAAATATTTTGGAACGTTTTTTGGCATTGCAACCATCT CTTTAGCAACTGGAGCACTAAAGCGAAAGAAGCCAGCCTTTCTCGTTCCTATAGTCCCGCTAAGCTTCAT CTTCACCTACCAGTATGACCTGGGCTACGGAACTCTCCTACAGAGAATGAAAAGTGAAGCTGAGGACATA TTGGAAACAGAAAAGACGAAGCTGGAGCTGCCAAAAGGACTGATCACCTTTGAAAGCCTTGAGAAAGCCA GAAGGGAGCAGAGTAAACTCTTCTCAGACAAATGAAGTCACAGTTATCCTCAGAGCACATATCGTGTCTC AAAAGCACAAAGTTGTTGGCTTGAATCATGGTGTTTACAGTTTTTTAAATGATCAAGATTTTGATATGAT GCATTTTTATTTTAGAATATTAAAATTCAAAATGAATTTGTTGAACTATTTTAAAATAAAATTTCTAACA CTCCAAAAAAAAAAAAAAAG
Restriction Sites RsrII-NotI     
ACCN NM_026362
Insert Size 444 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC024953, AAH24953
RefSeq Size 790 bp
RefSeq ORF 444 bp
Locus ID 67759
UniProt ID Q9D3P8
Gene Summary Receptor for plasminogen. Regulates urokinase plasminogen activator-dependent and stimulates tissue-type plasminogen activator-dependent cell surface plasminogen activation. Proposed to be part of a local catecholaminergic cell plasminogen activation system that regulates neuroendocrine prohormone processing. Involved in regulation of inflammatory response; regulates monocyte chemotactic migration and matrix metalloproteinase activation, such as of MMP2 and MMP9.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...