Asgr1 (NM_009714) Mouse Untagged Clone
CAT#: MC201987
Asgr1 (untagged) - Mouse asialoglycoprotein receptor 1 (Asgr1), (10ug)
CNY 3600.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | ASGPR1; Asgr; Asgr-1; HL-1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC022106 sequence for NM_009714
CCCACGCGTCCGCCATTGCCCAGGGCTCTTCACCTGGTTCTTCAGGCTTCAGCCCCCTCCTTAGCCTGGG CTCTTCGTGGTGCTGAGGGACCTTCAGTCCGGATCCAGTGCCATCATGACAAAGGATTATCAAGATTTCC AGCACCTGGACAATGATAATGACCATCATCAACTCCGGAGAGGGCCGCCTCCCACTCCACGGCTCTTGCA GCGACTCTGCTCTGGATCCCGCCTCCTCCTGCTCTCCTCGAGCCTCAGCATTCTGTTGCTGGTGGTTGTC TGTGTGATCACATCCCAAAATTCCCAACTCCGGGAAGATCTGCTGGCTCTAAGGCAGAATTTCAGCAACC TCACTGTGAGCACTGAGGACCAGGTCAAGGCCCTGAGCACCCAGGGAAGTAGTGTGGGAAGAAAGATGAA GTTAGTGGAGTCGAAGCTGGAAAAACAGCAGAAGGATCTGACTGAAGATCACTCCAGTTTGCTACTGCAC GTGAAGCAGTTAGTGTCTGACGTGCGAAGCTTGAGCTGCCAGATGGCTGCATTTCGGGGCAATGGCTCTG AAAGGACCTGCTGCCCCATCAACTGGGTGGAGTATGAAGGCAGCTGCTACTGGTTCTCCAGCTCTGTGAG GCCTTGGACTGAAGCTGACAAGTACTGCCAGCTGGAAAATGCCCATCTGGTGGTGGTGACCTCCAGGGAT GAGCAGAACTTCCTCCAGCGCCACATGGGCCCCTTAAACACTTGGATTGGCCTAACTGACCAGAACGGGC CCTGGAAATGGGTGGATGGAACAGACTACGAGACAGGCTTCCAGAATTGGAGACCAGAGCAGCCAGATAA CTGGTACGGACATGGGCTTGGAGGAGGCGAGGACTGTGCCCACTTCACGACGGATGGCCGCTGGAATGAC GACGTCTGCAGGAGGCCCTACCGCTGGGTCTGTGAGACAAAGTTGGATAAGGCTAATTAGGAACCTTCCT TCCCCTCATTTATATCCTTAATTCCTTGAGCTGCTGAGGTTTAGAACTGGTAGAGCCTACCTAAGGGTCT CCCCATCTCCAGGAACTCTCATGTAGGATTTTTAAAGGACCGGTAAAGAATGGTGTTTGAGAAATGGTGT ATGATGCCTGGTGGTGGTAGGGGTGCGTATTGAAACCCAGCGCGCAGTTCTCTTCTGTCAGCTTGTTTTT TTTAGAGTAAAAGGAAGAGAAATAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_009714 |
Insert Size | 855 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC022106, AAH22106 |
RefSeq Size | 1232 bp |
RefSeq ORF | 855 bp |
Locus ID | 11889 |
UniProt ID | P34927 |
Gene Summary | Mediates the endocytosis of plasma glycoproteins to which the terminal sialic acid residue on their complex carbohydrate moieties has been removed. The receptor recognizes terminal galactose and N-acetylgalactosamine units. After ligand binding to the receptor, the resulting complex is internalized and transported to a sorting organelle, where receptor and ligand are disassociated. The receptor then returns to the cell membrane surface.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Both variants 1 and 2 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203849 | Asgr1 (tGFP-tagged) - Mouse asialoglycoprotein receptor 1 (Asgr1) |
CNY 3140.00 |
|
MR203849 | Asgr1 (Myc-DDK-tagged) - Mouse asialoglycoprotein receptor 1 (Asgr1) |
CNY 3600.00 |
|
MR203849L3 | Lenti ORF clone of Asgr1 (Myc-DDK-tagged) - Mouse asialoglycoprotein receptor 1 (Asgr1) |
CNY 6000.00 |
|
MR203849L4 | Lenti ORF clone of Asgr1 (mGFP-tagged) - Mouse asialoglycoprotein receptor 1 (Asgr1) |
CNY 6000.00 |