Chchd3 (NM_025336) Mouse Untagged Clone
CAT#: MC201955
Chchd3 (untagged) - Mouse coiled-coil-helix-coiled-coil-helix domain containing 3 (Chchd3), (10ug)
CNY 2400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 0610041L09Rik; 1700039J09Rik; AW558177 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC021941 sequence for NM_025336
GGTCGTGGCCTTGCTCCTGCCCTGCAAGAGAAGCGTCCAGGGCTTTCACGCGCAAGTGTGCGCGTGGGTC CTGACGTGCTCGTAGGTCCACGCTCCAGACTCTGCGGGGACAGAAGCAGGAGCCATGGGCGGGACCGCTA GCACCCGCCGGGTCACCTTCGAGGCGGACGAGAACGAGAACATCACCGTGGTGAAGGGCATCCGGCTTTC AGAAAATGTGATCGACCGGATGAAGGAGTCCTCTCCATCTGGCTCTAAGTCTCAGCGATATTCCAGCGTT TATGGTGCTTCAGTTTCTGATGAAGATTTGAAAAGAAGAGTAGCTGAGGAGCTGGCATTGGAGCAAGCCA AAAAGGAGTCAGAACACCAGAGACGCCTTAAGCAAGCAAGGGACCTAGAAAGAGAAAGGGCTGCAGCCAA TGAGCAGCTGACCAGAGCTGTCCTTCGGGAAAGAATATCCAGTGAAGAGGAGCGCATGAAGGCGAAGCAT CTGGCTCGGCAGCTGGAAGAGAAAGACCGAGTGATGCGGAAGCAGGATGCATTCTACAAAGAGCAGCTGG CCAGACTGGAGGAGAGGAGCTCAGAGTTCTACAAAGTCACCACCGAGGAGTATCAGAAAGCTGCTGAAGA GGTGGAAGCCAAGTTCAAGCGGTATGAATATCATCCAGTCTGTGCAGATCTGCAGACCAAAATCCTCCAG TGTTACCGTCAGAACACCCAGCAGACTCTCAGCTGCTCTGCTCTGGCTAGCCAATACATGCACTGTGTCA ACCATGCCAAACAGAGCATGCTGGAGAAGGGAGGCTAAAGTTACCCTGAGAACATGCAAGCTCCTTCAAC GTTAATTCCAGAGGTGGAACATTTTTCTTTTCCTAGTATGAAAATGACCCATTTAAAGAGAAGACCACTA AAGACAGACAGGCACTGGAAAATGGACTCAACTGAATCATAACGTGTTTTGATCAACAGTTTAAAAAGCC ATGTTCTAGATCAGCGATCAGTCATCAAAGAACACTGTTAAGTGTTAATGAAACCACAAAATGAATAAAA GAGGAAGGCAGTCCACCCCAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_025336 |
| Insert Size | 684 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC021941, AAH21941 |
| RefSeq Size | 1084 bp |
| RefSeq ORF | 684 bp |
| Locus ID | 66075 |
| UniProt ID | Q9CRB9 |
| Gene Summary | Component of the MICOS complex, a large protein complex of the mitochondrial inner membrane that plays crucial roles in the maintenance of crista junctions, inner membrane architecture, and formation of contact sites to the outer membrane. Has also been shown to function as a transcription factor which binds to the BAG1 promoter and represses BAG1 transcription. Plays an important role in the maintenance of the MICOS complex stability and the mitochondrial cristae morphology.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR202692 | Chchd3 (Myc-DDK-tagged) - Mouse coiled-coil-helix-coiled-coil-helix domain containing 3 (Chchd3) |
CNY 2400.00 |
|
| MR202692L3 | Lenti ORF clone of Chchd3 (Myc-DDK-tagged) - Mouse coiled-coil-helix-coiled-coil-helix domain containing 3 (Chchd3) |
CNY 4750.00 |
|
| MR202692L4 | Lenti ORF clone of Chchd3 (mGFP-tagged) - Mouse coiled-coil-helix-coiled-coil-helix domain containing 3 (Chchd3) |
CNY 4750.00 |
