Psmb8 (NM_010724) Mouse Untagged Clone
CAT#: MC201912
Psmb8 (untagged) - Mouse proteasome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7) (Psmb8), (10ug)
CNY 2400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Lmp-7; Lmp7 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC051450 sequence for NM_010724
AAGAGGTAATCCCGGATCTTCGGGGCCAAGTGGCCATGGCGTTACTGGATCTGTGCGGTGCCGCTCGGGG GCAGCGGCCCGAGTGGGCTGCCCTGGATGCGGGAAGCGGGGGTCGCTCGGACCCGGGACACTACAGTTTC TCCGCGCAAGCTCCGGAGCTCGCACTTCCCCGGGGAATGCAGCCCACCGCATTCCTGAGGTCCTTTGGTG GTGACCAGGAAAGGAATGTTCAAATTGAGATGGCCCACGGCACAACCACACTCGCCTTCAAGTTCCAGCA TGGCGTCATCGTGGCTGTGGACTCCAGGGCCACTGCAGGGAGTTACATTAGCTCCTTAAGGATGAACAAA GTGATCGAGATTAACCCTTACCTGCTTGGCACCATGTCTGGTTGTGCAGCCGACTGCCAGTACTGGGAGA GGCTGTTGGCCAAGGAGTGCAGGTTGTGTTATCTTCGGAATGGGGAACGCATCTCCGTGTCTGCAGCATC CAAGCTGCTTTCCAACATGATGCTGCAGTACCGGGGGATGGGCCTCTCCATGGGCAGCATGATCTGTGGC TGGGACAAGAAGGGACCAGGACTTTACTACGTAGATGACAATGGGACTCGGCTCTCGGGACAGATGTTTC CCACTGGCAGCGGGAACACCTATGCCTATGGGGTGATGGACAGTGGTTACCGGCAGGACCTCAGTCCTGA AGAGGCCTACGACCTTGGCCGCAGAGCTATTGCTTATGCTACCCACAGAGACAACTATTCTGGAGGAGTC GTCAACATGTACCACATGAAGGAAGACGGTTGGGTGAAAGTGGAGAGTTCCGATGTCAGTGACCTGCTGT ACAAGTACGGAGAGGCCGCTCTGTGATGGCTGCTGGGCAGGCCTCCCCCAGCATTGGTGGCACTGGCTGG CAGACTCAGAGACCTGGGACTACTTCAGTCTTAGGAAAAAGAAGGGCTCAACCTGGGCTGGAGACAAAGC TCTGTTTACCCTCTCGGCCCCCGCACTCACAGATACCTTCTAAGTACAATAAAAGAAAAACGGTTATAAA AAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_010724 |
| Insert Size | 831 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC051450, AAH51450 |
| RefSeq Size | 1062 bp |
| RefSeq ORF | 831 bp |
| Locus ID | 16913 |
| UniProt ID | P28063 |
| Gene Summary | The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. The proteasome has an ATP-dependent proteolytic activity. This subunit is involved in antigen processing to generate class I binding peptides. May participate in the inflammatory response pathway. Required for adipocyte differentiation (PubMed:21881205, PubMed:22341445, PubMed:8066463). May be involved in the generation of spliced peptides resulting from the ligation of two separate proteasomal cleavage products that are not contiguous in the parental protein (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG203694 | Psmb8 (tGFP-tagged) - Mouse proteosome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7) (Psmb8) |
CNY 2850.00 |
|
| MR203694 | Psmb8 (Myc-DDK-tagged) - Mouse proteasome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7) (Psmb8) |
CNY 2400.00 |
|
| MR203694L3 | Lenti ORF clone of Psmb8 (Myc-DDK-tagged) - Mouse proteasome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7) (Psmb8) |
CNY 4750.00 |
|
| MR203694L4 | Lenti ORF clone of Psmb8 (mGFP-tagged) - Mouse proteasome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7) (Psmb8) |
CNY 4750.00 |
