PD-L1 (Cd274) (NM_021893) Mouse Untagged Clone

CAT#: MC201908

PD-L1 / CD274 (untagged) - Mouse PD-L1 / CD274 antigen (PD-L1 / CD274), (10ug)



  "NM_021893" in other vectors (6)

CNY 2400.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (4)
CD274 Rabbit polyclonal Antibody
    • 100 ul

CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Synonyms A530045L16Rik; B7h1; PD-; Pdcd1l; Pdcd1l1; Pdcd1lg1; Pdl1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC201908 representing NM_021893.
Blue=ORF Red=Cloning site Green=Tag(s)

CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCGGCG
CGCCAGATCTCAAGCTTAACTAGCTAGCGGACCGAC
ATGAGGATATTTGCTGGCATTATATTCACAGCCTGCTGTCACTTGCTACGGGCGTTTACTATCACGGCT
CCAAAGGACTTGTACGTGGTGGAGTATGGCAGCAACGTCACGATGGAGTGCAGATTCCCTGTAGAACGG
GAGCTGGACCTGCTTGCGTTAGTGGTGTACTGGGAAAAGGAAGATGAGCAAGTGATTCAGTTTGTGGCA
GGAGAGGAGGACCTTAAGCCTCAGCACAGCAACTTCAGGGGGAGAGCCTCGCTGCCAAAGGACCAGCTT
TTGAAGGGAAATGCTGCCCTTCAGATCACAGACGTCAAGCTGCAGGACGCAGGCGTTTACTGCTGCATA
ATCAGCTACGGTGGTGCGGACTACAAGCGAATCACGCTGAAAGTCAATGCCCCATACCGCAAAATCAAC
CAGAGAATTTCCGTGGATCCAGCCACTTCTGAGCATGAACTAATATGTCAGGCCGAGGGTTATCCAGAA
GCTGAGGTAATCTGGACAAACAGTGACCACCAACCCGTGAGTGGGAAGAGAAGTGTCACCACTTCCCGG
ACAGAGGGGATGCTTCTCAATGTGACCAGCAGTCTGAGGGTCAACGCCACAGCGAATGATGTTTTCTAC
TGTACGTTTTGGAGATCACAGCCAGGGCAAAACCACACAGCGGAGCTGATCATCCCAGAACTGCCTGCA
ACACATCCTCCACAGAACAGGACTCACTGGGTGCTTCTGGGATCCATCCTGTTGTTCCTCATTGTAGTG
TCCACGGTCCTCCTCTTCTTGAGAAAACAAGTGAGAATGCTAGATGTGGAGAAATGTGGCGTTGAAGAT
ACAAGCTCAAAAAACCGAAATGATACACAATTCGAGGAGACGTAA

ACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAG
GATGACGACGATAAG
GTTTAAACGGCCGGCCGCGGT
Restriction Sites RsrII-NotI     
ACCN NM_021893
Insert Size 873 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC066841
RefSeq Size 3653 bp
RefSeq ORF 873 bp
Locus ID 60533
UniProt ID Q9EP73
MW 32.8 kDa
Gene Summary The protein encoded by this gene is an immune inhibitory receptor ligand that is expressed by hematopoietic and non-hematopoietic cells, such as T cells and B cells and various types of tumor cells. The encoded protein is a type I transmembrane protein that has immunoglobulin V-like and C-like domains. Interaction of this ligand with its receptor inhibits T-cell activation and cytokine production. During infection or inflammation of normal tissue, this interaction is important for preventing autoimmunity by maintaining homeostasis of the immune response. In tumor microenvironments, this interaction provides an immune escape for tumor cells through cytotoxic T-cell inactivation. Mice deficient for this gene display a variety of phenotypes including decreased allogeneic fetal survival rates and severe experimental autoimmune encephalomyelitis. [provided by RefSeq, Sep 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...