Hspe1 (NM_008303) Mouse Untagged Clone
CAT#: MC201854
Hspe1 (untagged) - Mouse heat shock protein 1 (chaperonin 10) (Hspe1), nuclear gene encoding mitochondrial protein, (10ug)
CNY 1200.00
CNY 2000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 10kDa; Hsp10; mt-cpn10 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC024385 sequence for NM_008303
GTGGCGGCGAAGGCGAGAGTCATGGCTGGACAAGCTTTTAGGAAGTTTCTTCCGCTCTTTGACAGAGTAT TGGTTGAAAGGAGTGCTGCCGAAACTGTAACCAAAGGTGGCATTATGCTTCCAGAAAAGTCTCAAGGAAA AGTGTTGCAAGCAACGGTCGTGGCTGTGGGGTCAGGAGGGAAAGGAAAGAGTGGAGAGATTGAGCCTGTC AGTGTGAAAGTTGGAGATAAAGTTCTTCTCCCAGAATATGGAGGCACCAAAGTAGTTCTAGATGACAAGG ATTATTTCTTATTTAGAGATAGTGACATTCTTGGAAAGTATGTCGACTGAAATCACTGTTGAAATGGTGT CACGTGAAGCTGCCATTCCACTGATGTCTGAACTATTTCATCATGTAAATAATTTCCATGCCTCCCTTTT ATAATAAACAGATGATGCCTAAACTGACAGCCATTGTCTCTGACCTTTAGTTTCACTGTACTGTTACAAA CATTTCCAAATAAAATGATGTAAATGAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_008303 |
| Insert Size | 309 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC024385, AAH24385 |
| RefSeq Size | 534 bp |
| RefSeq ORF | 309 bp |
| Locus ID | 15528 |
| UniProt ID | Q64433 |
| Gene Summary | Co-chaperonin implicated in mitochondrial protein import and macromolecular assembly. Together with Hsp60, facilitates the correct folding of imported proteins. May also prevent misfolding and promote the refolding and proper assembly of unfolded polypeptides generated under stress conditions in the mitochondrial matrix. The functional units of these chaperonins consist of heptameric rings of the large subunit Hsp60, which function as a back-to-back double ring. In a cyclic reaction, Hsp60 ring complexes bind one unfolded substrate protein per ring, followed by the binding of ATP and association with 2 heptameric rings of the co-chaperonin Hsp10. This leads to sequestration of the substrate protein in the inner cavity of Hsp60 where, for a certain period of time, it can fold undisturbed by other cell components. Synchronous hydrolysis of ATP in all Hsp60 subunits results in the dissociation of the chaperonin rings and the release of ADP and the folded substrate protein.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200324 | Hspe1 (tGFP-tagged) - Mouse heat shock protein 1 (chaperonin 10) (Hspe1) |
CNY 2850.00 |
|
| MR200324 | Hspe1 (Myc-DDK-tagged) - Mouse heat shock protein 1 (chaperonin 10) (Hspe1), nuclear gene encoding mitochondrial protein |
CNY 1200.00 |
|
| MR200324L3 | Lenti ORF clone of Hspe1 (Myc-DDK-tagged) - Mouse heat shock protein 1 (chaperonin 10) (Hspe1), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |
|
| MR200324L4 | Lenti ORF clone of Hspe1 (mGFP-tagged) - Mouse heat shock protein 1 (chaperonin 10) (Hspe1), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |
