Ostc (NM_025509) Mouse Untagged Clone

CAT#: MC201780

Ostc (untagged) - Mouse oligosaccharyltransferase complex subunit (Ostc), (10ug)



  "NM_025509" in other vectors (4)

CNY 1200.00

CNY 2000.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2310008M10Rik; 5730557H03Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC021935 sequence for NM_025509
GCGGAAGGCTGGAGGCCAGAGGGCTGGCCCTACCGCCGGGGACATGGAGACTCTGTACCGAGTCCCATTC TTAGTGCTCGAATGCCCCAACCTGAAGCTGAAGAAACCGCCCTGGGTGCACATGCCGTCGGCTATGACGG TGTACGCCCTGGTGGTGGTATCTTACTTCCTCATTACCGGAGGAATAATCTATGATGTTATCGTTGAACC TCCAAGTGTTGGCTCAATGACCGACGAACATGGGCATCAGAGACCAGTAGCTTTCTTGGCTTACAGAGTA AACGGACAGTATATCATGGAAGGGCTTGCGTCCAGCTTTCTCTTTACAATGGGAGGTTTAGGTTTCATAA TCCTGGACCGATCCAATGCACCAAACATACCGAAACTCAACAGGTTTCTTCTTCTGTTCATCGGCTTCGT CTGTGTTCTCCTGAGTTTCTTCATGGCCAGAGTGTTCATGAGAATGAAATTGCCGGGCTACCTGATGGGC TAGTGTCTTTTGAGAGGAAATCAGTGGATCCCGGATTTGCTCCTGTTAATGAAGTTTTAAAGGCTGACCC ACTCCCTCGTGCAATGTGGAAAAAAATGAAGAGCAGTGTAAACGCTGCACTGAGCGACACCCTAGCAAGC ACAGCAGAGCTAGGACCGGAAGTCACGGGATCAGAGACAAGTTCATTACAGTATTTCCCTTGATGACCTA CCCCAGTGTACCAGCTATGTTAAACGGCATTTTTTCTTAGTTTTTTATTTCTTAAAGAAAATATACTCCT CCTAAAACTTTGGTATTGAATAAAGTGATTATTTTTTACAAACCCGTCATCAGCTTTTGGACATGATATT TCTGATTTTCAGAAATTAACGCAAATTGAGAAGTATATTGTGAGAGCTGAGATATTTGGACGACTGGCCA GTTCCTGCAGTGGTGCTTTAAATGGCGTGTGTGCTACTCTGCAATTTCAGATGCATACGGGAGACTTGTT TCCTGAACAACATGATGTATGAAAGGAGCAGAAATAAATGATTTTTCTAATTAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_025509
Insert Size 450 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC021935, AAH21935
RefSeq Size 1066 bp
RefSeq ORF 450 bp
Locus ID 66357
UniProt ID Q78XF5
Gene Summary Subunit of the oligosaccharyl transferase (OST) complex that catalyzes the initial transfer of a defined glycan (Glc(3)Man(9)GlcNAc(2) in eukaryotes) from the lipid carrier dolichol-pyrophosphate to an asparagine residue within an Asn-X-Ser/Thr consensus motif in nascent polypeptide chains, the first step in protein N-glycosylation. N-glycosylation occurs cotranslationally and the complex associates with the Sec61 complex at the channel-forming translocon complex that mediates protein translocation across the endoplasmic reticulum (ER). All subunits are required for a maximal enzyme activity. May be involved in N-glycosylation of APP (amyloid-beta precursor protein). Can modulate gamma-secretase cleavage of APP by enhancing endoprotelysis of PSEN1.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...