Cela2a (NM_007919) Mouse Untagged Clone
CAT#: MC201774
Cela2a (untagged) - Mouse chymotrypsin-like elastase family, member 2A (Cela2a), (10ug)
CNY 3600.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | El; Ela; Ela-2; Ela2; Ela2a |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC026552 sequence for NM_007919
GGGACACACCATGATCAGGACACTGCTGCTATCTGCCTTGGTGGCTGGAGCCCTCAGCTGTGGGTACCCC ACTTATGAGGTGGAGGATGATGTGAGCAGGGTAGTTGGGGGTCAAGAGGCCACACCCAACACCTGGCCCT GGCAGGTCTCCCTGCAGGTCCTTTCCTCCGGAAGGTGGCGCCACAACTGCGGAGGCTCCCTGGTGGCCAA CAACTGGGTTCTGACAGCTGCCCATTGCCTCAGCAACTATCAGACCTACCGAGTGCTGCTGGGCGCACAC AGCCTCTCCAACCCCGGAGCTGGCTCTGCTGCTGTTCAAGTCTCTAAGCTTGTGGTCCACCAGAGGTGGA ACTCCCAAAACGTCGGCAATGGCTATGACATTGCCTTAATCAAACTGGCCAGCCCAGTGACCCTGAGCAA GAACATCCAGACAGCTTGCCTCCCACCCGCTGGCACCATTCTCCCGAGAAACTATGTCTGCTATGTCACA GGCTGGGGCCTGCTGCAGACCAATGGGAACAGTCCTGACACCCTGAGGCAGGGCCGCCTGCTGGTTGTGG ACTATGCCACCTGCTCCAGCGCTAGCTGGTGGGGAAGCTCTGTGAAGTCCAGCATGGTGTGCGCTGGTGG CGACGGCGTGACCTCCAGCTGCAATGGGGACTCTGGCGGACCACTGAATTGCCGGGCATCTAATGGCCAG TGGCAGGTGCATGGCATCGTGAGCTTCGGCTCCTCTCTGGGCTGCAACTACCCCCGCAAGCCATCCGTCT TCACCAGGGTCTCCAACTACATTGACTGGATCAACTCGGTGATGGCAAGGAACTAACTGAAGACATTACT GCCACTGTCCCCCTGGAAATGCCATAGAAAAGAAATAGTAATAAAGTAATTTAAGAATCACAAAAAAAAA AAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_007919 |
Insert Size | 816 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC026552, AAH26552 |
RefSeq Size | 917 bp |
RefSeq ORF | 816 bp |
Locus ID | 13706 |
UniProt ID | P05208 |
Gene Summary | This gene encodes a serine protease enzyme that hydrolyzes elastin. This gene is highly expressed in the pancreatic acinar cells where the encoded preproprotein undergoes processing including signal peptide cleavage to generate an inactive zymogen. The removal of N-terminal activation peptide from the zymogen by trypsin generates active elastase enzyme. This gene is also expressed in the mouse epidermis where it participates in pro-filaggrin processing. [provided by RefSeq, Jul 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203625 | Cela2a (tGFP-tagged) - Mouse elastase 2A (Ela2a) |
CNY 5200.00 |
|
MR203625 | Cela2a (Myc-DDK-tagged) - Mouse chymotrypsin-like elastase family, member 2A (Cela2a) |
CNY 3600.00 |
|
MR203625L3 | Lenti ORF clone of Cela2a (Myc-DDK-tagged) - Mouse chymotrypsin-like elastase family, member 2A (Cela2a) |
CNY 5890.00 |
|
MR203625L4 | Lenti ORF clone of Cela2a (mGFP-tagged) - Mouse chymotrypsin-like elastase family, member 2A (Cela2a) |
CNY 5890.00 |