Apoa1 (NM_009692) Mouse Untagged Clone

CAT#: MC201725

Apoa1 (untagged) - Mouse apolipoprotein A-I (Apoa1), (10ug)



  "NM_009692" in other vectors (4)

CNY 3600.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Al; Alp-1; Ap; apo-AI; Apoa-1; apoA-I; Brp-; Brp-14; Ltw-; Ltw-1; Lvtw; Lvtw-1; Se; Sep; Sep-1; Sep-2; Sep2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC019837 sequence for NM_009692
CGGACGCGTGGGCGGAGAGCTCCGGGGAGGTCACCCACACCCTTCAGGATGAAAGCTGTGGTGCTGGCCG TGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATG GGACAAAGTGAAGGATTTCGCTAATGTGTATGTGGATGCGGTCAAAGACAGCGGCAGAGACTATGTGTCC CAGTTTGAATCCTCCTCCTTGGGCCAACAGCTGAACCTGAATCTCCTGGAAAACTGGGACACTCTGGGTT CAACCGTTAGTCAGCTGCAGGAACGGCTGGGCCCATTGACTCGGGACTTCTGGGATAACCTGGAGAAAGA AACAGATTGGGTGAGACAGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTG GACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCG AGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATT TCGCGACCGCATGCGCACACACGTAGACTCTCTGCGCACACAGCTAGCGCCCCACAGCGAACAGATGCGC GAGAGCCTGGCCCAGCGCCTGGCTGAGCTCAAGAGCAACCCTACCTTGAACGAGTACCACACCAGGGCCA AAACCCACCTGAAGACACTTGGCGAGAAAGCCAGACCTGCGCTGGAGGACCTGCGCCATAGTCTGATGCC CATGCTGGAGACGCTTAAGACCAAAGCCCAGAGTGTGATCGACAAGGCCAGCGAGACTCTGACTGCCCAG TGAGGTGCCCGCTTCCACTCCCCACCCCCGCATTGGCTTTCTTACAATAAACCTTTCCAAAATGGAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_009692
Insert Size 795 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC019837, AAH19837
RefSeq Size 951 bp
RefSeq ORF 795 bp
Locus ID 11806
UniProt ID Q00623
Gene Summary This gene encodes a preproprotein that is proteolytically cleaved to yield a signal peptide and a proproptein that is subsequently processed to generate the active mature peptide. The encoded protein is the major protein component of plasma high density lipoprotein (HDL). This protein facilitates the removal of cholesterol and other fats from tissues by transporting them to the liver for excretion. This protein is a cofactor for lecithin cholesterolacyltransferase, an enzyme that catalyzes the conversion of free cholesterol to cholesteryl esters. Mutations in this gene in humans causes familial HDL deficiency, Tangier disease and familial visceral amyloidosis. Similar clinical features are exhibited by mice with mutations in this gene. This gene is clustered with three other apolipoprotein genes on chromosome 9. [provided by RefSeq, Dec 2013]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...