Prelid1 (NM_025596) Mouse Untagged Clone

CAT#: MC201658

Prelid1 (untagged) - Mouse PRELI domain containing 1 (Prelid1), (10ug)



  "NM_025596" in other vectors (4)

CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
PRELID1 Antibody - N-terminal region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2610524G07Rik; Preli
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC025859 sequence for NM_025596
GCGGTAGGGACCTGGGCGCGGTCCTGCGGAGATTGAGCTGCGAGCCTGGCGGGCGTGCGCCTAGCCACGT CCCCCCCACCCCCGGGCTCTTCACCCTGATGCTGCACGGGTGCTGAGCCCGTCCGGGTCGGGACGATGGT GAAGTATTTCCTGGGCCAGAGCGTGCTCCGAAGTTCCTGGGACCAAGTGTTCGCCGCCTTCTGGCAACGG TACCCGAATCCCTATAGCAAACATGTCTTAACCGAAGACATAGTGCACCGGGAGGTGACCCCCGACCAGA AGCTACTGTCCCGGAGACTCCTGACCAAGACCAACAGGATGCCACGTTGGGCAGAGCGACTGTTTCCTGC CAACGTTGCTCACTCCGTGTACATCCTGGAGGACTCTATTGTGGACCCCCAGAATCAGACCATGACCACC TTCACCTGGAACATCAACCATGCCCGGCTGATGGTGGTGGAGGAACGATGTGTTTACTGTGTGAACTCTG ACAATAGCGGCTGGACCGAAATCCGTCGGGAAGCCTGGGTCTCCTCTAGCTTATTTGGCGTCTCCAGAGC TGTCCAGGAATTTGGTCTTGCCCGGTTCAAAAGCAATGTGACCAAGACAATGAAGGGCTTTGAATACATC CTGGCCAAGCTACAAGGTGAGGCCCCTTCCAAAACCCTTGTTGAGACAGCCAAAGAGGCCAAAGAGAAAG CAAAGGAGACCGCACTGGCAGCTACAGAGAAGGCCAAGGACCTGGCCAACAAGGCCGCCACCAAGCAGCA GCAGCGGCAGCTCGTATAACTCGCTTCCTCTCCCTCTCCCCAGTGTACGTGATTATTAAAGAGCAACCTG CAGCCCTCTCTGCTGTCTGGGGTGGTGGGTCAGGGCCCTGTCCTGGTCAGCATCTGCACCACACCCAGCT CTGTCTGCCGGGCAGAGGGGTGCAGTGACTTGCCCAAGGTCACAGCAGTGCGCAGGTGATAGACTGTACG CTCCAAGAGGGCAGGGCTCCTTGTTTTATTCTCTGCTGTGTCCCAAGTACCCTGAACAATATTTAGCACA TAACAGGCACTCAATAAACACATGATTTGATTAGCCCCAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_025596
Insert Size 654 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC025859, AAH25859
RefSeq Size 1103 bp
RefSeq ORF 654 bp
Locus ID 66494
UniProt ID Q8R107
Gene Summary Involved in the modulation of the mitochondrial apoptotic pathway by ensuring the accumulation of cardiolipin (CL) in mitochondrial membranes. In vitro, the TRIAP1:PRELID1 complex mediates the transfer of phosphatidic acid (PA) between liposomes and probably functions as a PA transporter across the mitochondrion intermembrane space to provide PA for CL synthesis in the inner membrane. Regulates the mitochondrial apoptotic pathway in primary Th cells. Regulates Th cell differentiation by down-regulating STAT6 thereby reducing IL-4-induced Th2 cell number. May be important for the development of vital and immunocompetent organs (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...