Tnfrsf12a (NM_013749) Mouse Untagged Clone
CAT#: MC201655
Tnfrsf12a (untagged) - Mouse tumor necrosis factor receptor superfamily, member 12a (Tnfrsf12a), transcript variant 1, (10ug)
CNY 1200.00
CNY 2000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AI255180; C87282; Fn14; HPIP; TWEAK-R; TweakR |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC025860 sequence for NM_013749
GGGACCGGCAATCATGGCTTCGGCTTGGCCGCGGTCTCTGCCGCAGATCCTCGTGTTGGGATTCGGCTTG GTGTTGATGCGCGCCGCGGCCGGGGAGCAAGCACCAGGCACCTCCCCATGCTCTAGCGGCAGCTCCTGGA GCGCGGACCTCGACAAGTGCATGGACTGCGCTTCTTGTCCAGCGCGACCACACAGCGACTTCTGCCTGGG ATGCGCCGCAGCACCTCCTGCCCACTTCAGGCTACTGTGGCCCATTCTGGGGGGCGCTCTTAGTCTGGTC CTGGTTTTGGCGCTGGTTTCTAGTTTCCTGGTCTGGAGAAGATGCCGCCGGAGAGAAAAGTTTACTACCC CCATAGAGGAGACTGGTGGAGAGGGCTGCCCAGGTGTGGCACTGATCCAGTGAGGAGCACCCGCGCTGGG GCCCACTCGTCGTCCATTCATTCATTCTGGAGTCAGCCTGGCCTTCCAGACAGAAGCCGAGCCAGACTCT TTCAACCACAAGGGGGTGGGGCGAGGTGGTGATTCACCTCCAAGGACTGGGCTTAGAGTTCAGGGAGCCT TCCAAGGTGTCCAATTGCCCTATCTCTGGGTCTGGGGCAGACAGAGAGCCTCAATCTGGGTCACAAAGCG ACCCATACTAAGGAACTGCAGCATTTGCACAAGGGAATCTCTTGTTCCCCACAAGTCCTGGCAGTCTGGC TGACTTGAGGGGCAGACACAACACTGGGTCCCACCCACTCGGAGGGGCTATAATGCCACTCCCTGAGTTT TAGCCCTAGGAGTGGGTCAGATTGACAGACCTGTTCTTAACACTAAGGGGGCTGGCCCTCTGGGAGGGCT GGCCCCAGTACACACGGAAACAACCATCTCCCAAGGGGGGTGATATTTATTGTGGGGATAATGTTTGGAG GGGAGGGAGACTTATTAATAAAAGAATCTTTAACTTTAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_013749 |
| Insert Size | 390 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC025860, AAH25860 |
| RefSeq Size | 962 bp |
| RefSeq ORF | 390 bp |
| Locus ID | 27279 |
| UniProt ID | Q9CR75 |
| Gene Summary | Receptor for TNFSF12/TWEAK (By similarity). Weak inducer of apoptosis in some cell types. Promotes angiogenesis and the proliferation of endothelial cells. May modulate cellular adhesion to matrix proteins.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200721 | Tnfrsf12a (tGFP-tagged) - Mouse tumor necrosis factor receptor superfamily, member 12a (Tnfrsf12a) |
CNY 2800.00 |
|
| MR200721 | Tnfrsf12a (Myc-DDK-tagged) - Mouse tumor necrosis factor receptor superfamily, member 12a (Tnfrsf12a), transcript variant 1 |
CNY 1200.00 |
|
| MR200721L1 | Lenti ORF clone of Tnfrsf12a (Myc-DDK-tagged) - Mouse tumor necrosis factor receptor superfamily, member 12a (Tnfrsf12a), transcript variant 1 |
CNY 4750.00 |
|
| MR200721L2 | Lenti ORF clone of Tnfrsf12a (mGFP-tagged) - Mouse tumor necrosis factor receptor superfamily, member 12a (Tnfrsf12a), transcript variant 1 |
CNY 3600.00 |
|
| MR200721L3 | Lenti ORF clone of Tnfrsf12a (Myc-DDK-tagged) - Mouse tumor necrosis factor receptor superfamily, member 12a (Tnfrsf12a), transcript variant 1 |
CNY 4750.00 |
|
| MR200721L4 | Lenti ORF clone of Tnfrsf12a (mGFP-tagged) - Mouse tumor necrosis factor receptor superfamily, member 12a (Tnfrsf12a), transcript variant 1 |
CNY 3600.00 |
其它Tnfrsf12a产品
