Aptx (NM_001025444) Mouse Untagged Clone

CAT#: MC201629

Aptx (untagged) - Mouse aprataxin (Aptx), transcript variant 2, (10ug)



  "NM_001025444" in other vectors (3)

CNY 3656.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2410016G21Rik; AA388047; FHA-HIT
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC021872 sequence for NM_001025444
GCGGCGAGGCGCAGTAGAGCAGCGTGAAGTTTGTGGGTGTCCACAGTCGAGAGCTAAGATGCGAGTGTGC TGGTTGGTGAGACAGGACAGCAGGCACCAGCGAATCAAACTTCCCCATTTGGAAGCTGTTGTGATTGGTC GAAGCCCAGAGACCAAGATCACAGATAAGAAATGTTCCCGACAGCAAGTACAGTTGAAAGCAGAGTGTAA CAAGGGATATGTCAAAGTACAGCAGATGGGGGTCAACCCCACCAGCATTGACTCGGGCGTCATCGGGAAG GACCAAGAGAAGCTGCTGCTGCCTGGTCAGGTTCTCCACATGGTGAATGGACTTTATCCATACATCGTAG AGTTTGAGGAAGTGGCAGAGAGCCCTAACCTAACACAGAGGAAGAGAAAGAGGTCAGACTGTGATAGTGA GGAGATGGAAGCTGAGTCTGGGACAGGGCTGGCACCTGGGAGCAGCCCCAGCCAGTGCTCTGTGTCCCCT AAGAAGGACAAGAATGGAGCCACCAAAAAGGAATCACTGGGCCACTGGAGTCAAGGCTTGAAGATGTCTA TGAAAGACCCCAAAATGCAGGTTTACAAAGACGACCAGGTGGTGGTGATTAAGGATAAATACCCCAAGGC CCGTCACCACTGGCTGGTCTTACCGTGGGCCTCCATTTCCAGTCTGAAGGTTGTGACCAGTGAACACCTT GAACTTCTCAAACATATGCACGCTGTGGGGGAGAAGGTGATAGCAGAGTTTGCTGGATCCAGCAAACTGC GCTTCCGATTGGGCTACCATGCCATTCCCAGCATGAGCCACGTACATCTTCATGTGATCAGCCAGGATTT TGATTCTCCTTGCCTTAAAAACAAAAAGCATTGGAATTCTTTTAATACAGAATACTTTCTGGAATCACAA GCTGTGATCAAGATGGTTCAGGAAGCCGGCAGAGTGACTGTTAAAGATGGCACTTGTGAGCTCTTGAAGC TGCCTCTCCGTTGCCATGAGTGTCAGCAGCTGCTGCCTTCCATCCCGCAGCTGAAAGAGCACCTCAGGAA GCACTGGGGCGGGTGACACTCGTCTCGGCGACCAAGGGCAGTGCTAGCATCTATCCGCATTGCCTATGCT CCATTCAATCCTGAACTAAAGCGTACACTTCTTCGAAACAAAGCTTATTTATTCTTGAGCGGCCACACAT TGGTTGCACTCTGGTGTAAGAACTGGGAATTTGGGTTTTGTGGGTGTATTCTCTGGTAATGGAGGCTGAG ACATGCCTGGTCACCCTTCCCAGGACCATGACAGGCCTGACTAATGAGAGGGCAGAGCCGGCTTGAGACT CAAATGCACGATGTAGAAGCAGAGGATTGGTAATATATTTTGTTTCTACCCTCAAAAAAAAAAAAAAAAA AAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_001025444
Insert Size 1008 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC021872, AAH21872
RefSeq Size 1407 bp
RefSeq ORF 1008 bp
Locus ID 66408
UniProt ID Q7TQC5
Gene Summary DNA-binding protein involved in single-strand DNA break repair, double-strand DNA break repair and base excision repair. Resolves abortive DNA ligation intermediates formed either at base excision sites, or when DNA ligases attempt to repair non-ligatable breaks induced by reactive oxygen species. Catalyzes the release of adenylate groups covalently linked to 5'-phosphate termini, resulting in the production of 5'-phosphate termini that can be efficiently rejoined (PubMed:16964241). Also able to hydrolyze adenosine 5'-monophosphoramidate (AMP-NH(2)) and diadenosine tetraphosphate (AppppA), but with lower catalytic activity (By similarity). Likewise, catalyzes the release of 3'-linked guanosine (DNAppG) and inosine (DNAppI) from DNA, but has higher specific activity with 5'-linked adenosine (AppDNA) (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and the 5' coding region and intiates translation at a downstream start codon, compared to variant 1. It encodes isoform b, which has a shorter N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...