Nme4 (NM_019731) Mouse Untagged Clone

CAT#: MC201533

Nme4 (untagged) - Mouse non-metastatic cells 4, protein expressed in (Nme4), nuclear gene encoding mitochondrial protein, (10ug)



  "NM_019731" in other vectors (4)

CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2610027N22Rik; 2810024O08Rik; 5730493H09Rik; NM23-M4; Nm23M4
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC027277 sequence for NM_019731
CTTTGCGCGGCGTTCAATGCGGCGCCAGCCCGCAACATGGGCAGCCTTTTCGGGCGCGTCGCGGCGCTGC GGGCGCTGTTGTGCGGGCCACGCTTTCAGTGCCTGCTGGTGCGCCCCAGTTCCGGAGGCCCCCCCTGGCC CCAAGAGCGGACGCTGGTTGCTGTGAAGCCAGATGGGGTACAGAGGAGGCTAGTGGGGACTGTGATACAA CGCTTTGAGAGGCGGGGCTTCAAGCTGGTGGGGATGAAGATGTTGCAGGCACCAGAAAGCATCCTTGCTG AGCACTACCGGGACCTACAGAGGAAGCCATTCTACCCAGCTCTTATCAGCTACATGAGCTCTGGGCCTGT GGTGGCCATGGTCTGGGAAGGCCCCAATGTGGTTCATATCTCAAGGGCCATGATAGGACACACCGACTCA ACAGAGGCAGCCCCTGGGACAATCAGGGGCGACTTCAGTGTTCACATCAGCAGGAACGTCATCCATGCTA GCGATTCTGTGGATGGGGCCCAGAGGGAGATCGAGCTGTGGTTTCAGAGCAGCGAACTGTTGAACTGGGC AGATGGTGGTCACCACAGCAGCTGCTACCCTGCCTGAGGGCTTGCACTGCCTTCTGCACTTCAGGTCTAC CCATGACCTACTACCTCTGTCAACAAGAAGTCAAGCCCCCATGCTTCCCATGTCCCCAAACCACTCCCTA CTCTCGCTCTACCCAACTCCAGCCCAGGGGAGTCTAAGCCTCAACTCTATGTGCCTTTTTGTATCCTAAG TCAATACAATATTGGACCATGTCCTTGTGTACAAAAGTGCCAGACAATCTTTGGGGCATTGTCAAAGGTG ACTTCACCTGCCTCAAAGGAGAGACATTAAAATTTTATGCTTAAAATGGAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_019731
Insert Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC027277, AAH27277
RefSeq Size 905 bp
RefSeq ORF 561 bp
Locus ID 56520
UniProt ID Q9WV84
Gene Summary Major role in the synthesis of nucleoside triphosphates other than ATP. The ATP gamma phosphate is transferred to the NDP beta phosphate via a ping-pong mechanism, using a phosphorylated active-site intermediate. Through the catalyzed exchange of gamma-phosphate between di- and triphosphonucleosides participates in regulation of intracellular nucleotide homeostasis. Binds to anionic phospholipids, predominantly to cardiolipin; the binding inhibits its phosphotransfer activity. Acts as mitochondria-specific NDK; its association with cardiolipin-containing mitochondrial inner membrane is coupled to respiration suggesting that ADP locally regenerated in the mitochondrion innermembrane space by its activity is directly taken up via ANT ADP/ATP translocase into the matrix space to stimulate respiratory ATP regeneration. Proposed to increase GTP-loading on dynamin-related GTPase OPA1 in mitochondria. In vitro can induce liposome cross-linking suggesting that it can cross-link inner and outer membranes to form contact sites, and promotes intermembrane migration of anionic phosphoplipids. Promotes the redistribution of cardiolipin between the mitochondrial inner membrane and outer membrane which is implicated in pro-apoptotic signaling (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...