Cd3g (NM_009850) Mouse Untagged Clone

CAT#: MC201401

Cd3g (untagged) - Mouse CD3 antigen, gamma polypeptide (Cd3g), (10ug)



  "NM_009850" in other vectors (4)

CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Ctg-3; Ctg3; T3g
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC027528 sequence for NM_009850
AGGGACTCTCAATACTTCTACTGGAGAAGCAAAGAGACTGACATGGAGCAGAGGAAGGGTCTGGCTGGCC TCTTCCTGGTGATCTCTCTTCTTCAAGGCACTGTAGCCCAGACAAATAAAGCAAAGAATTTGGTACAAGT GGATGGCAGCCGAGGAGACGGTTCTGTACTTCTGACTTGTGGCTTGACTGACAAGACTATCAAGTGGCTT AAAGACGGGAGCATAATAAGTCCTCTAAATGCAACTAAAAACACATGGAATCTGGGCAACAATGCCAAAG ACCCTCGAGGCACGTATCAGTGTCAAGGAGCAAAGGAGACATCAAACCCCCTGCAAGTGTATTACAGAAT GTGTGAAAACTGCATTGAGCTAAACATAGGCACCATATCCGGCTTTATCTTCGCTGAGGTCATCAGCATC TTCTTCCTTGCTCTTGGTGTATATCTCATTGCGGGACAGGATGGAGTTCGCCAGTCAAGAGCTTCAGACA AGCAGACTCTGTTGCAAAATGAACAGCTGTACCAGCCCCTCAAGGACCGGGAATATGACCAGTACAGCCA TCTCCAAGGAAACCAACTGAGGAAGAAGTGAACTCAGCAGGACTCAGGGTGTCCCCCCTTCTATCCAGCA CCCAGAATCAAAACAATGCATTTTGGAGAGAGCCCAGTAGAGAGATTTTCAACCCTACAGGTAGACTGCA AGCAGAGAGGAAGAACTGTCAAAGAAATTTTGGTCTTTTTTTTTTTTTTTTCAAAATAAAATAAAAGCTT GGAGGAGCCAAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_009850
Insert Size 549 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC027528, AAH27528
RefSeq Size 800 bp
RefSeq ORF 549 bp
Locus ID 12502
UniProt ID P11942
Gene Summary Part of the TCR-CD3 complex present on T-lymphocyte cell surface that plays an essential role in adaptive immune response. When antigen presenting cells (APCs) activate T-cell receptor (TCR), TCR-mediated signals are transmitted across the cell membrane by the CD3 chains CD3D, CD3E, CD3G and CD3Z. All CD3 chains contain immunoreceptor tyrosine-based activation motifs (ITAMs) in their cytoplasmic domain. Upon TCR engagement, these motifs become phosphorylated by Src family protein tyrosine kinases LCK and FYN, resulting in the activation of downstream signaling pathways. In addition to this role of signal transduction in T-cell activation, CD3G plays an essential role in the dynamic regulation of TCR expression at the cell surface. Indeed, constitutive TCR cycling is dependent on the di-leucine-based (diL) receptor-sorting motif present in CD3G (PubMed:25920998).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...