Hscb (NM_153571) Mouse Untagged Clone
CAT#: MC201343
Hscb (untagged) - Mouse HscB iron-sulfur cluster co-chaperone homolog (E. coli) (Hscb), (10ug)
CNY 1200.00
CNY 2000.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI325508; AW049829; Hsc20 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC027641 sequence for NM_153571
AGCGGCCGTCCCAATGTGGGGATGCGGAGCCCGTGCCCTGCTGGGTGTGTGGGAGGTGCGGCTGGCAGGG TTCCTGGGAAGGAGACTTTTGGGCAGCAATGCCGCCGCGGGGAAGAGCATTGCACCGCAGTGCTGGAACT GCGGTCACGCAAGGGAAGCCGGGTGTGGGGATGAGTTCTTCTGCTCACACTGCCGCGCTCTGCAGCCTCC TGACCCCACTCGTGACTACTTCAGCCTCATGAACTGCAACCGCTCCTTCAGGGTGGACGTTACGAAACTT CAGCACAGGTACCAGCAACTGCAGCGGCTTGTCCACCCAGATTTCTTCAGCCAAAAGTCTCAGACTGAAA AACACTTCTCTGACAAGCACTCCACCCTGGTGAATGATGCCTATAAGACTCTTCAGGCTCCCCTGACCAG AGGACTATATCTTCTAAAGCTCCAGGGAATAGAAATTCCTGAAGGGACAGATTACAAAGCAGACAGTCAG TTCCTTGTGGAAATCATGGAAATCAATGAAAGACTCGCAGACGCCCAAAGTGAGGCCGCCATGGAAGAGA TAGAAGCCACTGTCAGAGCTAAACAGAAAGAATTTACTGACAATATAAACAGCGCTTTTGAACAAGGTGA CTTTGAAAAAGCCAAGGAACTCCTGACAAAGATGAGATACTTTTCGAACATAGAAGAAAAGATCAAGCTA AGCAAGACTCCTCTCTAGTTGCTAACTTAAAGTTTTAGAAATAAACTTTGTATTTCTTTTCTGGCTTCAA AAAAAAAAAAAAAAAAAAA |
Restriction Sites | EcoRI-NotI |
ACCN | NM_153571 |
Insert Size | 480 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC027641, AAH27641 |
RefSeq Size | 789 bp |
RefSeq ORF | 480 bp |
Locus ID | 100900 |
UniProt ID | Q8K3A0 |
Gene Summary | Acts as a co-chaperone in iron-sulfur cluster assembly in both mitochondria and the cytoplasm. Required for incorporation of iron-sulfur clusters into SDHB, the iron-sulfur protein subunit of succinate dehydrogenase that is involved in complex II of the mitochondrial electron transport chain. Recruited to SDHB by interaction with SDHAF1 which first binds SDHB and then recruits the iron-sulfur transfer complex formed by HSC20, HSPA9 and ISCU through direct binding to HSC20. Also mediates complex formation between components of the cytosolic iron-sulfur biogenesis pathway and the CIA targeting complex composed of CIAO1, DIPK1B/FAM69B and MMS19 by binding directly to the scaffold protein ISCU and to CIAO1. This facilitates iron-sulfur cluster insertion into a number of cytoplasmic and nuclear proteins including POLD1, ELP3, DPYD and PPAT.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201219 | Hscb (tGFP-tagged) - Mouse HscB iron-sulfur cluster co-chaperone homolog (E |
CNY 2850.00 |
|
MR201219 | Hscb (Myc-DDK-tagged) - Mouse HscB iron-sulfur cluster co-chaperone homolog (E. coli) (Hscb) |
CNY 1200.00 |
|
MR201219L3 | Lenti ORF clone of Hscb (Myc-DDK-tagged) - Mouse HscB iron-sulfur cluster co-chaperone homolog (E. coli) (Hscb) |
CNY 4750.00 |
|
MR201219L4 | Lenti ORF clone of Hscb (mGFP-tagged) - Mouse HscB iron-sulfur cluster co-chaperone homolog (E. coli) (Hscb) |
CNY 4750.00 |