Aif1 (NM_019467) Mouse Untagged Clone

CAT#: MC201324

Aif1 (untagged) - Mouse allograft inflammatory factor 1 (Aif1), (10ug)



  "NM_019467" in other vectors (4)

CNY 1200.00

CNY 2000.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Iba1 Rabbit monoclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI607846; AIF-1; D17H6S50E; G1; Iba1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC021539 sequence for NM_019467
CCACGCGTCCGCTGGGGTGCTGGTGTCAGCAGAAGCTGATGTGGAAGTGATGCCTGGGAGTTAGCAAGGG AATGAGTGGAAAGGGGAAGTGTGAGAACGGTCCCAGAAGAGACTGGGGAGCTGGTGGAGAGAGGACCCAG CGGACAGACTGCCAGCCTAAGACAACCAGCGTCTGAGGAGCCATGAGCCAAAGCAGGGATTTGCAGGGAG GAAAAGCTTTTGGACTGCTGAAGGCCCAGCAGGAAGAGAGGCTGGAGGGGATCAACAAGCAATTCCTCGA TGATCCCAAATACAGCAATGATGAGGATCTGCCGTCCAAACTTGAAGCCTTCAAGGTGAAATACATGGAG TTTGATCTGAATGGAAATGGAGATATCGATATTATGTCCTTGAAGCGAATGCTGGAGAAACTTGGGGTTC CCAAGACCCACCTAGAGCTGAAGAGATTAATTAGAGAGGTGTCCAGTGGCTCCGAGGAGACGTTCAGCTA CTCTGACTTTCTCAGAATGATGCTGGGCAAGAGATCTGCCATCTTGAGAATGATTCTGATGTATGAGGAG AAAAACAAAGAACACAAGAGGCCAACTGGTCCCCCAGCCAAGAAAGCTATCTCCGAGCTGCCCTGATTGG AGGTGGATGTCACACGGTGGGGCTGAGTGAGGAGCTTCTGATGACAGCAGCATGGAAAAAAGAAACAGTC GTGAGCCAGAGTCAGACTAAATAAATGACGCTCCTAGTGGGTCAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_019467
Insert Size 444 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC021539, AAH21539
RefSeq Size 780 bp
RefSeq ORF 444 bp
Locus ID 11629
UniProt ID O70200
Gene Summary Actin-binding protein that enhances membrane ruffling and RAC activation. Enhances the actin-bundling activity of LCP1. Binds calcium. Plays a role in RAC signaling and in phagocytosis. May play a role in macrophage activation and function. Promotes the proliferation of vascular smooth muscle cells and of T-lymphocytes. Enhances lymphocyte migration. Plays a role in vascular inflammation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...