Rbm8a (NM_025875) Mouse Untagged Clone
CAT#: MC201215
Rbm8a (untagged) - Mouse RNA binding motif protein 8a (Rbm8a), transcript variant 2, (10ug)
CNY 2400.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2310057C03Rik; AA673428; Rbm8 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC020086 sequence for NM_025875
GCGCCGAGAGAAGCAAGATGGCGGACGTGCTGGATCTTCACGAGGCGGGGGGCGAAGATTTCGCCATGGA TGAGGATGGGGACGAAAGCATCCACAAACTAAAAGAAAAAGCAAAGAAACGGAAGGGCCGCGGCTTTGGC TCCGAGGGGTCCCGAGCGCGGATGCGGGAGGATTACGACAGTGTGGAGCAGGACGGCGATGAACCTGGAC CACAGCGCTCTGTTGAAGGTTGGATTCTCTTTGTCACTGGAGTCCACGAAGAAGCCACTGAAGAAGATAT CCATGACAAATTCGCTGAATATGGGGAAATAAAAAATATTCACCTTAATTTGGACAGGCGCACGGGATAC TTGAAGGGGTATACTCTAGTTGAATATGAAACATACAAAGAGGCTCAGGCTGCCATGGAAGGACTAAATG GTCAAGATTTGATGGGGCAGCCAATCAGTGTGGACTGGTGTTTTGTTCGTGGACCACCAAAGGGCAAGAG GAGAGGAGGCCGAAGACGAAGCAGGAGTCCAGACCGGAGACGCCGTTGATAAATCCTCTGTCGACTGGGT GGTCTCTCTACAAGTCCATTTGGTTATGCTGCCTTGGATAAACAGGGCTAGGGCGGACCTTGTGTTTATA TTTAATTTCTTACCCTATCTACTTGGCATTGCTTTTGAGTTTTAGAAAAAAATAAATGTTCCATTTTGTT TTCTAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_025875 |
Insert Size | 522 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC020086, AAH20086 |
RefSeq Size | 722 bp |
RefSeq ORF | 522 bp |
Locus ID | 60365 |
UniProt ID | Q9CWZ3 |
Gene Summary | Required for pre-mRNA splicing as component of the spliceosome (By similarity). Core component of the splicing-dependent multiprotein exon junction complex (EJC) deposited at splice junctions on mRNAs. The EJC is a dynamic structure consisting of core proteins and several peripheral nuclear and cytoplasmic associated factors that join the complex only transiently either during EJC assembly or during subsequent mRNA metabolism. The EJC marks the position of the exon-exon junction in the mature mRNA for the gene expression machinery and the core components remain bound to spliced mRNAs throughout all stages of mRNA metabolism thereby influencing downstream processes including nuclear mRNA export, subcellular mRNA localization, translation efficiency and nonsense-mediated mRNA decay (NMD). Its removal from cytoplasmic mRNAs requires translation initiation from EJC-bearing spliced mRNAs. Associates preferentially with mRNAs produced by splicing. Does not interact with pre-mRNAs, introns, or mRNAs produced from intronless cDNAs. Associates with both nuclear mRNAs and newly exported cytoplasmic mRNAs (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the end of an exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201494 | Rbm8a (tGFP-tagged) - Mouse RNA binding motif protein 8a (Rbm8a) |
CNY 2850.00 |
|
MG218181 | Rbm8a (tGFP-tagged) - Mouse RNA binding motif protein 8a (Rbm8a) transcript variant 2, (10ug) |
CNY 2090.00 |
|
MR218181 | Rbm8a (Myc-DDK-tagged) - Mouse RNA binding motif protein 8a (Rbm8a), transcript variant 2 |
CNY 1900.00 |
|
MR218181L3 | Lenti ORF clone of Rbm8a (Myc-DDK-tagged) - Mouse RNA binding motif protein 8a (Rbm8a), transcript variant 2 |
CNY 3800.00 |
|
MR218181L4 | Lenti ORF clone of Rbm8a (mGFP-tagged) - Mouse RNA binding motif protein 8a (Rbm8a), transcript variant 2 |
CNY 3800.00 |