Pcsk1n (NM_013892) Mouse Untagged Clone
CAT#: MC201129
Pcsk1n (untagged) - Mouse proprotein convertase subtilisin/kexin type 1 inhibitor (Pcsk1n), (10ug)
CNY 2400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AI848336; bLEN; KEP; lLEN; Pan3; PEN; PEN19; PEN20; proSAAS; SAAS; SAASCT |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC012263 sequence for NM_013892
CCCGGCTCGTTGGGGCAGCATGGCGGGGTCGCCGCTGCTCTGCGGGCCGCGGGCCGGGGGCGTCGGCATT TTGGTGCTGCTGCTCTTGGGCCTTCTGAGGCTGCCCCCCACCCTGTCAGCGAGGCCCGTGAAGGAGCCCC GCAGTCTGAGCGCAGCATCCGCGCCCTTGGTTGAGACGAGCACTCCCCTCCGCTTGCGTCGGGCCGTGCC CCGAGGAGAGGCGGCGGGTGCGGTGCAGGAGCTGGCGCGGGCGCTGGCGCACCTGCTGGAGGCCGAGAGA CAGGAACGCGCGCGTGCTGAGGCGCAGGAGGCTGAGGATCAGCAGGCGCGTGTCCTGGCGCAGCTGCTGC GCGCCTGGGGCTCTCCGCGTGCCTCGGACCCGCCCTTGGCCCCCGACGATGACCCGGACGCTCCAGCTGC ACAGCTCGCCCGTGCTCTGCTCCGAGCTCGCCTAGACCCGGCCGCCCTGGCAGCCCAACTTGTCCCCGCC CCTGCCGCTGCGCCGCGACCCCGGCCCCCAGTGTATGATGATGGCCCCACTGGCCCAGACGTCGAGGATG CCGGCGACGAGACTCCTGACGTGGACCCTGAGCTGCTGAGGTACTTGCTAGGGCGGATCCTCACCGGAAG TTCGGAGCCAGAGGCTGCTCCTGCCCCGCGCCGCCTCCGCCGATCTGTGGACCAGGATTTGGGTCCCGAG GTGCCCCCTGAGAACGTACTGGGGGCTCTGCTACGCGTCAAACGCCTGGAGAACCCCTCGCCCCAGGCGC CGGCACGCCGCCTCCTGCCTCCCTGAGCGCTGCTGCATCCTGCACGCCCTGGAACCCAGGAGCGCCCCAG CAACCCTGACTCCCTGCCAGCACGTCCAAGGCTGCTTACCCCAGCAACCTCCCATCCCCTGAGCCCTCAA TAAATGCCATCTGTAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_013892 |
| Insert Size | 777 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC012263, AAH12263 |
| RefSeq Size | 975 bp |
| RefSeq ORF | 777 bp |
| Locus ID | 30052 |
| UniProt ID | Q9QXV0 |
| Gene Summary | May function in the control of the neuroendocrine secretory pathway. Proposed be a specific endogenous inhibitor of PCSK1. ProSAAS and Big PEN-LEN, both containing the C-terminal inhibitory domain, but not the processed peptides reduce PCSK1 activity in the endoplasmic reticulum and Golgi. It reduces the activity of the 87 kDa form but not the autocatalytically derived 66 kDa form of PCSK1. Subsequent processing of proSAAS may eliminate the inhibition. Slows down convertase-mediated processing of proopiomelanocortin and proenkephalin. May control the intracellular timing of PCSK1 rather than its total level of activity. The function of the processed secreted peptides is not known.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG203342 | Pcsk1n (tGFP-tagged) - Mouse proprotein convertase subtilisin/kexin type 1 inhibitor (Pcsk1n) |
CNY 2850.00 |
|
| MR203342 | Pcsk1n (Myc-DDK-tagged) - Mouse proprotein convertase subtilisin/kexin type 1 inhibitor (Pcsk1n) |
CNY 2400.00 |
|
| MR203342L3 | Lenti ORF clone of Pcsk1n (Myc-DDK-tagged) - Mouse proprotein convertase subtilisin/kexin type 1 inhibitor (Pcsk1n) |
CNY 4750.00 |
|
| MR203342L4 | Lenti ORF clone of Pcsk1n (mGFP-tagged) - Mouse proprotein convertase subtilisin/kexin type 1 inhibitor (Pcsk1n) |
CNY 4750.00 |
