Fis1 (NM_025562) Mouse Untagged Clone
CAT#: MC201086
Fis1 (untagged) - Mouse fission 1 (mitochondrial outer membrane) homolog (yeast) (Fis1), nuclear gene encoding mitochondrial protein, transcript variant 1, (10ug)
CNY 1200.00
CNY 2000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2010003O14Rik; Ttc11 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC010783 sequence for NM_025562
GCCTCTCCGCCCCTGCTACTGGACCATGGAGACTGTGGCCCAGTAGAGACCTTAGTGTGAGGCTTTCAGG GGCGGCGGCCATGGAGGCCGTGCTGAACGAGCTGGTGTCTGTGGAGGATCTGAAGAATTTTGAAAGGAAA TTTCAGTCTGAGCAGGCAGCTGGTTCTGTGTCCAAGAGCACGCAATTTGAATATGCCTGGTGCCTGGTTC GAAGCAAATACAATGAGGACATCCGCAGAGGCATCGTGCTGCTGGAGGAGCTGTTGCCCAAAGGGAGCAA AGAGGAACAGCGGGACTATGTCTTCTACCTGGCCGTGGGCAACTACCGGCTCAAGGAATATGAAAAGGCT CTAAAGTATGTGCGAGGGCTGTTGCAGACTGAGCCCCAGAACAACCAGGCCAAGGAGCTGGAACGCCTGA TTGATAAGGCCATGAAGAAAGATGGACTGGTAGGCATGGCCATCGTTGGTGGCATGGCCCTGGGCGTGGC AGGCCTGGCTGGACTCATTGGACTGGCTGTCTCCAAGTCCAAATCCTGAAGGCAGCCTCACCTGCTCTCT GCCCCGGGACGCCTAGGAGCCTGGGGGACACTGGAAGAGGGGCCTGTCCACCCTCACCATCGCCTTCCCG TTTCTCCTGCACCCCTGTAGTCTACCTCTACAGTCTCCATGACCCCCAGCCTCTTAGCCCCTGCACCTGT CGTTTAACCCTGTCATGCTTTGCAATGAGTGTAAATAAAATTGGGCCGTGGCTCGGGAAAAAAAAAAAAA AAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_025562 |
| Insert Size | 459 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC010783, AAH10783 |
| RefSeq Size | 773 bp |
| RefSeq ORF | 459 bp |
| Locus ID | 66437 |
| UniProt ID | Q9CQ92 |
| Gene Summary | Involved in the fragmentation of the mitochondrial network and its perinuclear clustering. Plays a minor role in the recruitment and association of the fission mediator dynamin-related protein 1 (DNM1L) to the mitochondrial surface and mitochondrial fission. May be not essential for the assembly of functional fission complexes and the subsequent membrane scission event. Can induce cytochrome c release from the mitochondrion to the cytosol, ultimately leading to apoptosis. Also mediates peroxisomal fission.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201095 | Fis1 (tGFP-tagged) - Mouse fission 1 (mitochondrial outer membrane) homolog (yeast) (Fis1) |
CNY 2850.00 |
|
| MR201095 | Fis1 (Myc-DDK-tagged) - Mouse fission 1 (mitochondrial outer membrane) homolog (yeast) (Fis1), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 1200.00 |
|
| MR201095L3 | Lenti ORF clone of Fis1 (Myc-DDK-tagged) - Mouse fission 1 (mitochondrial outer membrane) homolog (yeast) (Fis1), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 4750.00 |
|
| MR201095L4 | Lenti ORF clone of Fis1 (mGFP-tagged) - Mouse fission 1 (mitochondrial outer membrane) homolog (yeast) (Fis1), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 4750.00 |
