Slamf7 (BC011154) Mouse Untagged Clone
CAT#: MC201060
Slamf7 (untagged) - Mouse SLAM family member 7 (cDNA clone MGC:19034 IMAGE:4168309), (10ug)
CNY 2400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 19A, CS1, 19A24, CRACC |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC011154
CCTGAAAACGCTATGGCTCGTTTCTCAACGTACATCATCTTTACCTCTGTCCTCTGTCAGCTAACAGTCA CAGCAGCTTCTGGAACTCTGAAGAAGGTGGCCGGTGCCCTTGATGGATCTGTGACATTCACTCTGAATAT CACTGAAATAAAGGTTGACTATGTTGTATGGACGTTCAACACATTCTTTCTTGCCATGGTAAAAAAAGAC GGCGTTACATCACAAAGTAGTAACAAAGAAAGGATAGTCTTTCCAGATGGACTCTACTCCATGAAGCTCA GCCAATTGAAGAAGAATGACTCTGGAGCCTACCGTGCAGAGATTTACAGTACATCGAGTCAGGCTTCCTT AATCCAGGAGTATGTGCTGCATGTCTACAAGCATTTGTCAAGGCCCAAGGTCACCATAGATCGGCAAAGC AACAAGAATGGCACCTGCGTAATCAATCTGACATGTTCCACGGATCAGGACGGGGAGAATGTAACCTACA GCTGGAAAGCTGTGGGGCAGGGGGACAATCAGTTTCATGATGGTGCCACCCTCTCCATCGCCTGGAGATC AGGAGAGAAAGACCAGGCCTTAACATGCATGGCCAGGAATCCAGTCAGCAACAGTTTCTCAACCCCCGTC TTTCCCCAGAAGCTCTGTGAAGATGCTGCCACGGATCTAACTTCACTCAGGGGCATCCTATACATCCTGT GCTTCTCAGCAGTGCTCATCCTATTTGCTGTCTTGCTGACTATTTTTCATACTACGTGGATAAAGAAAAG AAAAGAAAAGAAGACCAGAAGAAGATGCACCAAACACATTTTATTCCACTGTGCAGATCCCCAAAGTGGT AAAGAGTCCCAGCTCCCTGCCTGCAAAGCCACTCGTGCCAAGGTCATTAAGCTTTGAAAATGTTATCTAG ATGACAGCACTCCGTCCTCTCCAGAAAAAAACAAAACAAAACAAAACTGCAAAACAAACAAAACCTCACC ATTCTGAGCAGAAATGAAAACTTCTGTCAAAGACTGAATGTAAATGTCTCCCCGCCAGACCCACATGTTT GCATCCAGACAGAGAAGTTCAGGCTCAAGGGCTTTCAGGGTACAATGACTCTTGGGGACTGGGATACAGC CCATTCAGACATTCTGACTAAGAATCTCTCTATGCCCATCCTGTCTCCGGTAATGATGAATGAGGCTGTG CTCATAGGCAGTGGACTAATTTGTCTGATGAAGAAATTTTTGACAAAGCGCAGCATCTAGGCTGTGGCAC AGCCATGTTCGCTGTTTTTATTCACATTTATAGCTGTATGTAAATAATCTCAATCATTCAGTTCCCAGAT AAAAGACGCATAGACGCATAAAAATTAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | BC011154 |
| Insert Size | 885 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC011154, AAH11154 |
| RefSeq Size | 1373 bp |
| RefSeq ORF | 885 bp |
| Locus ID | 75345 |
| Gene Summary | Self-ligand receptor of the signaling lymphocytic activation molecule (SLAM) family. SLAM receptors triggered by homo- or heterotypic cell-cell interactions are modulating the activation and differentiation of a wide variety of immune cells and thus are involved in the regulation and interconnection of both innate and adaptive immune response. Activities are controlled by presence or absence of small cytoplasmic adapter proteins, SH2D1A/SAP and/or SH2D1B/EAT-2 (PubMed:19648922). Mediates natural killer (NK) cell activation through a SH2D1A-independent extracellular signal-regulated ERK-mediated pathway (By similarity). Positively regulates NK cell functions by a mechanism dependent on the adapter SH2D1B. In addition to heterotypic NK cells-target cells interactions also homotypic interactions between NK cells may contribute to activation. However, in the absence of SH2D1B, inhibits NK cell function. Acts also inhibitory in T-cells (PubMed:19151721). May play a role in lymphocyte adhesion (By similarity). In LPS-activated monocytes negatively regulates production of proinflammatory cytokines (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG204058 | Slamf7 (tGFP-tagged) - Mouse SLAM family member 7 (cDNA clone MGC:19034 IMAGE:4168309) |
CNY 2850.00 |
|
| MR204058 | Slamf7 (Myc-DDK-tagged) - Mouse SLAM family member 7 (cDNA clone MGC:19034 IMAGE:4168309) |
CNY 2400.00 |
|
| MR204058L3 | Lenti ORF clone of Slamf7 (Myc-DDK-tagged) - Mouse SLAM family member 7 (cDNA clone MGC:19034 IMAGE:4168309) |
CNY 4750.00 |
|
| MR204058L4 | Lenti ORF clone of Slamf7 (mGFP-tagged) - Mouse SLAM family member 7 (cDNA clone MGC:19034 IMAGE:4168309) |
CNY 4750.00 |
