Mad2l2 (NM_027985) Mouse Untagged Clone

CAT#: MC200866

Mad2l2 (untagged) - Mouse MAD2 mitotic arrest deficient-like 2 (yeast) (Mad2l2), (10ug)



  "NM_027985" in other vectors (4)

CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2310033C13Rik; G1-453-4; MAD2B; repro22; REV7
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC011282 sequence for NM_027985
GCGCGTTAGGGGTCTCAGACGGTGGTTTCTATAGCCCGGTCGTAGATTGGAACCTGAGGTCGAAACCGGA GCCGGCGAATCGGGGAGGAGCGTAGAGAGGGCGGGATTTCCGCCGAGAGGGATCCGGCTGCTCAGGGGGC GGGGCTTCCCCCGACCGGGCTGCGTTTCCCGCGTGCGGGGTCGGTTGCCTTGAGTCCCTACAGACACCCT CCACGCCCTCCCCCAGGCGGCCAAGGATGACCACCCTCACGCGCCAAGACCTCAACTTTGGCCAAGTGGT GGCTGACGTGCTCTCCGAGTTCCTGGAGGTGGCCGTGCACCTGATTCTCTATGTGCGCGAGGTCTACCCG GTGGGCATCTTCCAGAAGCGCAAGAAGTACAACGTGCCGGTTCAGATGTCCTGTCATCCGGAGCTGAACC AGTACATCCAGGACACACTCCACTGCGTCAAACCTCTCCTGGAGAAGAACGATGTGGAGAAGGTGGTGGT GGTGATTTTGGATAAGGAACACCGCCCAGTGGAGAAGTTTGTCTTTGAGATCACTCAGCCTCCCTTGCTG TCCATCAATTCAGACTCCCTCCTGTCTCATGTGGAGCAGCTGCTTCGAGCCTTCATCCTTAAGATTAGTG TGTGTGATGCTGTCCTGGATCACAACCCTCCAGGCTGCACATTTACAGTCCTCGTGCACACAAGAGAAGC TGCTACTCGAAACATGGAGAAGATACAGGTCATCAAGGACTTCCCATGGATCCTGGCAGATGAACAGGAT GTCCACATGCACGACCCCCGCTTGATACCCCTAAAAACCATGACGTCGGACATTTTAAAGATGCAGCTCT ACGTTGAAGAGCGAGCGCATAAGAACAGCTGAGGACATGCCTGTCACCAGCTACCCAGCTGTCCCACTAC GGGGCCCCAGCCCGGGGCCCCAGACTCCAAGTGCTCTTATTGCCTTGACATGTGGCTGCCCCTCTGGTCA GGCTGCCCAGCCCTGCTTGCCTTCGTGAGGCAGCCTTCCCAGGAGCTGGGGAAGGATGCGAGGACACACG CCATTTCTCAGCAGCCTCCTGGGCTCAGCTGGCTAACATTGTCCACTGTGCCATGCGTTATTGTTAATAA AGTGGCCCCAAGGGCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_027985
Insert Size 636 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC011282, AAH11282
RefSeq Size 1176 bp
RefSeq ORF 636 bp
Locus ID 71890
UniProt ID Q9D752
Gene Summary Adapter protein able to interact with different proteins and involved in different biological processes. Mediates the interaction between the error-prone DNA polymerase zeta catalytic subunit REV3L and the inserter polymerase REV1, thereby mediating the second polymerase switching in translesion DNA synthesis. Translesion DNA synthesis releases the replication blockade of replicative polymerases, stalled in presence of DNA lesions. Component of the shieldin complex, which plays an important role in repair of DNA double-stranded breaks (DSBs). During G1 and S phase of the cell cycle, the complex functions downstream of TP53BP1 to promote non-homologous end joining (NHEJ) and suppress DNA end resection. Mediates various NHEJ-dependent processes including immunoglobulin class-switch recombination, and fusion of unprotected telomeres. May also regulate another aspect of cellular response to DNA damage through regulation of the JNK-mediated phosphorylation and activation of the transcriptional activator ELK1. Inhibits the FZR1- and probably CDC20-mediated activation of the anaphase promoting complex APC thereby regulating progression through the cell cycle. Regulates TCF7L2-mediated gene transcription and may play a role in epithelial-mesenchymal transdifferentiation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...