Cldn3 (BC012650) Mouse Untagged Clone

CAT#: MC200803

Cldn3 (untagged) - Mouse claudin 3 (cDNA clone MGC:13769 IMAGE:4217040), (10ug)



CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal anti-Cldn3 antibody
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI182374; Cpetr2; mRVP1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC012650
CCACGCGTCCGCCCTGAGCTGCCCGGCCGAGCCGGTTCAAGTCCAGCAGCCATGTCCATGGGCCTGGAGA TCACCGGCACGTCGCTGGCCGTGCTGGGCTGGCTGTGCACCATCGTGTGCTGCGCCCTTCCCATGTGGCG CGTTTCGGCCTTCATCGGCAGCAGCATCATCACGGCGCAGATCACCTGGGAGGGCCTGTGGATGAACTGC GTGGTGCAGAGCACCGGTCAGATGCAGTGCAAAATGTACGACTCGCTGCTGGCCGCCTTCGGGCTCCTCG TGGCGCTCGTGGGCGCCCAGTGTACCAACTGCGTACAAGACGAGACGGCCAAGGCCAAGATCACCATCGT GGCGGGAGTGCTTTTCCTGTTGGCGGCTCTGCTCACCTTAGTACCGGTGTCCTGGTCGGCCAACACCATC ATCAGGGATTTCTATAACCCGTTGGTGCCCGAGGCCCAGAAGCGGGAGATGGGAGCTGGGTTGTACGTGG GCTGGGCTGCCGCCGCGCTGCAGTTGCTAGGGGGCGCCTTGCTGTGTTGCTCCTGCCCACCGCGCGACAA GTATGCACCCACCAAGATCCTCTATTCTGCGCCGCGATCCACCGGCCCTGGCACCGGTACCGGCACCGCC TACGACCGCAAGGACTACGTCTGAGGGGCCGGGTGCACGCAGACCGTACCGTCACCACTACCAGCAGTCG ATGAACCCCACCCGTCCAGCGTGCAGCCTCGCGTCTGAGACTACCGGGCCTAGGAACTGTCCAAGCCGAA TGGACAAAGAAACCTCGCCCTTCCCAAGAACTGGGCTGGGGTGGCCACTGCAGCTACTTGCCAGCCCCGC AGAAGCTCACAGTGGGCAGAGACAGGCAAACCATGAAACGGGCCATTTCATATTTTTCAATAAAAGTCTT TCGTTTTTTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN BC012650
Insert Size 603 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC012650, AAH12650
RefSeq Size 999 bp
RefSeq ORF 603 bp
Locus ID 12739
Gene Summary This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a low-affinity receptor for clostridium perfringens enterotoxin (CPE) produced by the bacterium Clostridium perfringens, and the interaction with CPE results in increased membrane permeability by forming small pores in plasma membrane. This protein is highly overexpressed in uterine carcinosarcoma. This protein is also predominantly present in brain endothelial cells, where it plays a specific role in the establishment and maintenance of blood brain barrier tight junction morphology. [provided by RefSeq, Aug 2012]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...