Pde6d (NM_008801) Mouse Untagged Clone

CAT#: MC200755

Pde6d (untagged) - Mouse phosphodiesterase 6D, cGMP-specific, rod, delta (Pde6d), (10ug)



  "NM_008801" in other vectors (3)

CNY 1200.00

CNY 2000.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI841218; PrBP/delta
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC005636 sequence for NM_008801
CTGAGGGGAGGGAGAGGCCGGTTCGGGTCTGGCCGCCACCGCTGTTCACCTGAGGTGTCCGGCCGGGCTG CGGCTGTCCTCGGTTCCTGGGTACCGTCTGCGAGGCCCCGCGGAGCCAGCGTGGGAGGGCCGCGGGCGGC AGGCGCCGCATCATGTCAGCCAAGGACGAGCGGGCCAGGGATATCCTGAGAGGCTTCAAACTAAATTGGA TGAACCTTCGGGATGCCGAAACAGGGAAGATACTCTGGCAAGGAACAGAAGACCTGTCTGTCCCTGGTGT GGAACATGAAGCCCGTGTGCCCAAGAAAATCCTCAAGTGCAAGGCAGTGTCTCGAGAATTGAACTTTTCT TCAGCAGAACAAATGGAAAAATTCCGCCTGGAACAAAAAGTTTACTTCAAAGGACAATGCCTAGAAGAGT GGTTCTTCGAGTTTGGCTTTGTGATCCCTAACTCCACAAACACCTGGCAGTCCTTGATAGAAGCAGCGCC TGAGTCCCAGATGATGCCCGCCAGCGTCCTAACGGGCAATGTCATCATAGAGACAAAGTTCTTTGACGAT GATCTTCTTGTCAGCACATCCAAAGTGAGGCTTTTCTATGTTTGAGAGAATTTGTGTGCACTTCTAAGAA TTTGGCCGGGGGCAGGAGGAAGCTGAACTTGTTCTCTGCACACCTGACTGGGATACTCCAGCTGACTCAC TCCTTCAACACAGAACCCACCTGTGCACCAGGAAACCAGCTCTGAATAGACGGCCAGTGGCTTTTCTCCC AAAACCTCCATCTTCACTGACAAGACTAAACTCCCAACCCCAGCCAAAGGCAGGGATAAGCCTCGACTCC TTCCTGGCGCAAACATGGGAACAAACCCTCCCAGGAGCCACGCTGCGCCTGTCACCTGCCTGCCTCCTCC TTGGGCCCCACAGGCTTTCTTTAGCCTCTGGTTTTGAAAAAATTTTACCTTTCTGACCCATTTAGGTTTT TCCTACCACTTGTATTTCATACATTCTCATACCTTTAACTTGTAAAATAGACTATGATATTATTATTACA TAATGTAATTAAGGCATTAAAATATTCCTACAGTCTTTAGCAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_008801
Insert Size 453 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC005636, AAH05636
RefSeq Size 1109 bp
RefSeq ORF 453 bp
Locus ID 18582
UniProt ID O55057
Gene Summary Promotes the release of prenylated target proteins from cellular membranes (PubMed:22179043). Modulates the activity of prenylated or palmitoylated Ras family members by regulating their subcellular location (PubMed:22179043). Required for normal ciliary targeting of farnesylated target proteins, such as INPP5E (By similarity). Modulates the subcellular location of target proteins by acting as a GTP specific dissociation inhibitor (GDI) (PubMed:22179043). Increases the affinity of ARL3 for GTP by several orders of magnitude. Stabilizes ARL3-GTP by decreasing the nucleotide dissociation rate.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...