Pde6d (NM_008801) Mouse Untagged Clone
CAT#: MC200755
Pde6d (untagged) - Mouse phosphodiesterase 6D, cGMP-specific, rod, delta (Pde6d), (10ug)
CNY 1200.00
CNY 2000.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI841218; PrBP/delta |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC005636 sequence for NM_008801
CTGAGGGGAGGGAGAGGCCGGTTCGGGTCTGGCCGCCACCGCTGTTCACCTGAGGTGTCCGGCCGGGCTG CGGCTGTCCTCGGTTCCTGGGTACCGTCTGCGAGGCCCCGCGGAGCCAGCGTGGGAGGGCCGCGGGCGGC AGGCGCCGCATCATGTCAGCCAAGGACGAGCGGGCCAGGGATATCCTGAGAGGCTTCAAACTAAATTGGA TGAACCTTCGGGATGCCGAAACAGGGAAGATACTCTGGCAAGGAACAGAAGACCTGTCTGTCCCTGGTGT GGAACATGAAGCCCGTGTGCCCAAGAAAATCCTCAAGTGCAAGGCAGTGTCTCGAGAATTGAACTTTTCT TCAGCAGAACAAATGGAAAAATTCCGCCTGGAACAAAAAGTTTACTTCAAAGGACAATGCCTAGAAGAGT GGTTCTTCGAGTTTGGCTTTGTGATCCCTAACTCCACAAACACCTGGCAGTCCTTGATAGAAGCAGCGCC TGAGTCCCAGATGATGCCCGCCAGCGTCCTAACGGGCAATGTCATCATAGAGACAAAGTTCTTTGACGAT GATCTTCTTGTCAGCACATCCAAAGTGAGGCTTTTCTATGTTTGAGAGAATTTGTGTGCACTTCTAAGAA TTTGGCCGGGGGCAGGAGGAAGCTGAACTTGTTCTCTGCACACCTGACTGGGATACTCCAGCTGACTCAC TCCTTCAACACAGAACCCACCTGTGCACCAGGAAACCAGCTCTGAATAGACGGCCAGTGGCTTTTCTCCC AAAACCTCCATCTTCACTGACAAGACTAAACTCCCAACCCCAGCCAAAGGCAGGGATAAGCCTCGACTCC TTCCTGGCGCAAACATGGGAACAAACCCTCCCAGGAGCCACGCTGCGCCTGTCACCTGCCTGCCTCCTCC TTGGGCCCCACAGGCTTTCTTTAGCCTCTGGTTTTGAAAAAATTTTACCTTTCTGACCCATTTAGGTTTT TCCTACCACTTGTATTTCATACATTCTCATACCTTTAACTTGTAAAATAGACTATGATATTATTATTACA TAATGTAATTAAGGCATTAAAATATTCCTACAGTCTTTAGCAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_008801 |
Insert Size | 453 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC005636, AAH05636 |
RefSeq Size | 1109 bp |
RefSeq ORF | 453 bp |
Locus ID | 18582 |
UniProt ID | O55057 |
Gene Summary | Promotes the release of prenylated target proteins from cellular membranes (PubMed:22179043). Modulates the activity of prenylated or palmitoylated Ras family members by regulating their subcellular location (PubMed:22179043). Required for normal ciliary targeting of farnesylated target proteins, such as INPP5E (By similarity). Modulates the subcellular location of target proteins by acting as a GTP specific dissociation inhibitor (GDI) (PubMed:22179043). Increases the affinity of ARL3 for GTP by several orders of magnitude. Stabilizes ARL3-GTP by decreasing the nucleotide dissociation rate.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR201058 | Pde6d (Myc-DDK-tagged) - Mouse phosphodiesterase 6D, cGMP-specific, rod, delta (Pde6d) |
CNY 1200.00 |
|
MR201058L3 | Lenti ORF clone of Pde6d (Myc-DDK-tagged) - Mouse phosphodiesterase 6D, cGMP-specific, rod, delta (Pde6d) |
CNY 4750.00 |
|
MR201058L4 | Lenti ORF clone of Pde6d (mGFP-tagged) - Mouse phosphodiesterase 6D, cGMP-specific, rod, delta (Pde6d) |
CNY 4750.00 |