Jtb (NM_206924) Mouse Untagged Clone
CAT#: MC200626
Jtb (untagged) - Mouse jumping translocation breakpoint (Jtb), (10ug)
CNY 1200.00
CNY 2000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Gm622 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC008139 sequence for NM_206924
CAGCAAACAGACGAGAGCACCCGGGAAGAGTCGGCGTCGCCAGTGCCGGGACCAGGAGCCTCCGCGAGCA AGATGGCCGCTCCCGAGACCGAGGCCGAGGGGCACGGGCACTAGGTCCGGACCCGCGTACCCCTTTCCCG GACGCCTGCGTCCCCACAAAGACCTCGTGCTTCTAGCAAGACACCCGCATGGATTATTCTCGCTGTGGTC ACGAGGCCGTTCCTATAGCGCTCTAGTTGGCCCAGACTGAGAACTCTGGCATCTGGCTGCTCGGAGCTGG AACCTCAGGGAGGTCTGCTGCAACAGGTGCGACCCTGACCGCTCCATGCTCGCGGGCGCGGGGAGGCGTG GCCTCCCCCGGGCCGGCCACCTCTGTTGGCTGCTGTGCGCTTTCACCTTAAAACTCTGCGAGGCAGAGGC TCCGGTGCGCGAGGAGAAGCTATCAGTGAGCACTTCAACTTCGCCATGTTGGTTGGCAGAAGAGTTTGTG GTGACTGAAGAGTGTACTCCGTGTTCTAACTTCCAGATTAAAACAACACCTGAGTGTGGTTCTACAGGGT ATGTGGAAAAAATCACATGCAGCTCATCTAAGAGGAATGAATTCAAAAGCTGCCGTTCGGCTCTACTGGA ACAACACTTATTCTGGAAATTTGAAGGCGTTGTGGTGGCTGTAGCTTTAGTCTTCGCCTGCCTTGTCATC GTTCGTCAGCGACAACTGGACAGAAAGGCTCTTGAAAAAGTCAGGAAGCAAATTGAGTCCATATAGCTGA ATTTCTACTGTATTATGGTGGCTCTTTACGGACTGTATCTCAGATGGAGAAAGTTCAGCGGCTAATTTGC ACTCGTAAACCTGTGGTAGTAGCATTTTCAATGACTTCCTCTTCTAGACCATTAATGAGCACAATAAAAA GTAAAATAGAGCTGGACATGACACAGACTTGGAATCCCAGCACTTGAGAGAATGAGGCAGGAGGATCCTT GGTAACTTTGTAGGCCGACTAGGCTGAACTACATAGTAAGCCTGTCTTTAAAGAGAAAACGGAAATAATA AAGGAGTAAAGAGTTAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_206924 |
| Insert Size | 441 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC008139, AAH08139 |
| RefSeq Size | 1078 bp |
| RefSeq ORF | 441 bp |
| Locus ID | 23922 |
| UniProt ID | O88824 |
| Gene Summary | Required for normal cytokinesis during mitosis. Plays a role in the regulation of cell proliferation. May be a component of the chromosomal passenger complex (CPC), a complex that acts as a key regulator of mitosis. The CPC complex has essential functions at the centromere in ensuring correct chromosome alignment and segregation and is required for chromatin-induced microtubule stabilization and spindle assembly. Increases AURKB activity (By similarity). Inhibits apoptosis induced by TGFB1. Overexpression induces swelling of mitochondria and reduces mitochondrial membrane potential.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200972 | Jtb (tGFP-tagged) - Mouse jumping translocation breakpoint (Jtb) |
CNY 2850.00 |
|
| MR200972 | Jtb (Myc-DDK-tagged) - Mouse jumping translocation breakpoint (Jtb) |
CNY 1200.00 |
|
| MR200972L3 | Lenti ORF clone of Jtb (Myc-DDK-tagged) - Mouse jumping translocation breakpoint (Jtb) |
CNY 4750.00 |
|
| MR200972L4 | Lenti ORF clone of Jtb (mGFP-tagged) - Mouse jumping translocation breakpoint (Jtb) |
CNY 4750.00 |
