S100a13 (BC005687) Mouse Untagged Clone

CAT#: MC200570

S100a13 (untagged) - Mouse S100 calcium binding protein A13 (cDNA clone MGC:11475 IMAGE:3155915), (10ug)



CNY 1200.00

CNY 2000.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC005687
GCTTGCACCACCTCCCTGAGCCTAGCGGGAACAGCAGTAGCAGTCCCTCTAACACAGACTCCCAAGTAGC CCTCATAATTGGGAGGGATGAGACCCTGTGGTCCTTCCTGATCAGGCTGTGTCCCAGTCGCGTGGCGCTG TGTTGGGATGGCTAGTGACAGCAGGGGCGGTCCCCTCAGCGGAGGCGGAAACTTGACACTTCAGACTTGG GAGTGGCTCTCGCCTTGCCTGGTGCTTATAAACTTCAGCCTCAGGGCTCCAGATCGGTTAGCTGCATCCC ACCTTCTTTCCCGGTCAATCTGTGTGGACATCAGCTCCTGCTTTGGTATACTGATGGCAGCAGAGACTCT GACTGAACTGGAGGCGGCCATTGAGACTGTGGTCTCTACTTTCTTCACCTTTGCAGGGCGGGAAGGACGC AAAGGCAGCCTGAACATCAATGAATTTAAGGAACTGGCCACTCAGCAACTGCCTCATTTGCTCAAGGACG TGGGCTCTCTAGATGAAAAGATGAAGACCTTGGATGTGAATCAGGACTCAGAGCTGAGGTTCAGTGAATA CTGGAGACTGATTGGAGAGCTGGCAAAGGAAGTCAGGAAGGAGAAGGCCCTGGGGATCCGGAAGAAGTAA AGCTTGCTGTCCAGCAGGACCTGTTGGGCAGAGCCAGGCAGCACTCCACCCCTGCCCCCAAATAAAGCTT TCTTCTTGAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN BC005687
Insert Size 297 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC005687, AAH05687
RefSeq Size 723 bp
RefSeq ORF 297 bp
Locus ID 20196
Gene Summary Plays a role in the export of proteins that lack a signal peptide and are secreted by an alternative pathway. Binds two calcium ions per subunit. Binds one copper ion. Binding of one copper ion does not interfere with calcium binding. Required for the copper-dependent stress-induced export of IL1A and FGF1. The calcium-free protein binds to lipid vesicles containing phosphatidylserine, but not to vesicles containing phosphatidylcholine.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...