Derl2 (NM_033562) Mouse Untagged Clone
CAT＃: MC200559
Derl2 (untagged) - Mouse Der1-like domain family, member 2 (Derl2), (10ug)
CNY 2400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | CGI-101; Derlin-2; F-lana; Flana |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC005682 sequence for NM_033562
GGAAAGATGGCGTACCAGAGCCTCCGGCTGGAGTACCTGCAGATCCCGCCGGTCAGCCGCGCCTATACTA CCGCCTGCGTCCTCACCACCGCGGCCGTGCAGTTGGAATTGATCACACCTTTTCAGTTATACTTCAATCC TGAATTAATTTTTAAACATTTTCAAATCTGGAGGCTAATCACCAATTTCTTATTTTTTGGTCCAGTTGGA TTCAATTTTTTGTTTAACATGATTTTTCTATACCGTTATTGTCGAATGCTAGAAGAAGGCTCTTTCCGAG GTCGGACAGCAGACTTTGTATTTATGTTCCTTTTTGGTGGATTTTTAATGACTCTCTTTGGTTTGTTTGT GAGCTTAGTTTTTTTAGGCCAGGCCTTTACAATAATGCTGGTCTACGTGTGGAGCCGAAGGAACCCGTAT GTCCGCATGAACTTCTTTGGTCTTCTAAACTTCCAGGCCCCCTTCCTGCCCTGGGTGCTCATGGGGTTTT CCCTGTTGCTGGGGAACTCAATTATAGTGGACCTTTTGGGTATTGCAGTTGGGCACATATATTTTTTCTT GGAAGATATATTTCCCAATCAGCCTGGTGGAATAAGAATTCTGAAAACACCATCTATTTTGAGGACTATT TTTGATACGCCAGATGAGGATCCCAATTACAACCCACTACCTGAAGAGCGGCCGGGAGGCTTCGCCTGGG GTGAGGGCCAGCGCCTTGGTGGGTAAAGCAGCGGTGCCAATTACGAGACCCATCTGAGAAAGACTCAGTG ACATGTCCATGGGGGTCTTTTATCCCTTGTTGCAAAAGCGTGGACAGTTTTGACAGCTTGACAGATTTTT AACTCCAGAAGCACTTTACGGGATGGTACACTGACTAACATAGAAGACATTTCCAGGAGTTTGCCAGGGG TTCCTCACTATGCTGGTACTAAAAGTATAACCTCTTGGAGCCAAAAACTGGAGACCCAGGCACCCTGCCT GTGCCGTGAGCAAGTCCATGGGTACTTGAGCTCAGTGGCACAGGCGGGTGCTCCTCCTCCTCTTTGATAG ACAAGGCCGTGGTGTAAATGGAAGTTACGGAGAGGACAAAATAAAACTGAATTCCATCTCTCTCACACTG TAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_033562 |
| Insert Size | 720 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC005682, AAH05682 |
| RefSeq Size | 1137 bp |
| RefSeq ORF | 720 bp |
| Locus ID | 116891 |
| UniProt ID | Q8BNI4 |
| Gene Summary | Functional component of endoplasmic reticulum-associated degradation (ERAD) for misfolded lumenal glycoproteins, but not that of misfolded nonglycoproteins. May act by forming a channel that allows the retrotranslocation of misfolded glycoproteins into the cytosol where they are ubiquitinated and degraded by the proteasome. May mediate the interaction between VCP and misfolded glycoproteins. May also be involved in endoplasmic reticulum stress-induced pre-emptive quality control, a mechanism that selectively attenuates the translocation of newly synthesized proteins into the endoplasmic reticulum and reroutes them to the cytosol for proteasomal degradation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (a). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG202943 | Derl2 (tGFP-tagged) - Mouse Der1-like domain family, member 2 (Derl2) |
CNY 2850.00 |
|
| MR202943 | Derl2 (Myc-DDK-tagged) - Mouse Der1-like domain family, member 2 (Derl2) |
CNY 2400.00 |
|
| MR202943L3 | Lenti ORF clone of Derl2 (Myc-DDK-tagged) - Mouse Der1-like domain family, member 2 (Derl2) |
CNY 4750.00 |
|
| MR202943L4 | Lenti ORF clone of Derl2 (mGFP-tagged) - Mouse Der1-like domain family, member 2 (Derl2) |
CNY 4750.00 |
