Vps29 (NM_019780) Mouse Untagged Clone

CAT#: MC200554

Vps29 (untagged) - Mouse vacuolar protein sorting 29 (S. pombe) (Vps29), (10ug)



  "NM_019780" in other vectors (4)

CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2010015D08Rik; AW049835; PEP11
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC005663 sequence for NM_019780
GGAAGAGGGCGGCGGCGTTCGTGGTGATTGTACGGAGCCCTGGTGACAGGATGTTGGTGTTGGTACTAGG AGATCTGCACATTCCGCACCGGTGCAACAGCCTGCCGGCCAAGTTTAAAAAACTCCTGGTGCCAGGAAAA ATCCAGCACATCCTCTGCACCGGCAACCTCTGCACCAAGGAGAGCTACGACTATCTCAAGACTCTGGCTG GCGACGTCCACATCGTGAGAGGAGACTTCGATGAGAATCTGAATTACCCAGAACAAAAGGTTGTGACTGT GGGCCAGTTCAAGATCGGTCTGATTCACGGACACCAAGTTATTCCGTGGGGAGACATGGCTAGCTTAGCC CTGCTGCAGAGGCAGTTTGATGTGGACATTCTTATCTCAGGACACACACACAAATTTGAAGCATTTGAGC ATGAAAATAAATTCTACATTAACCCAGGTTCTGCCACTGGGGCCTATAATGCCTTGGAAACAAACATTAT TCCATCGTTTGTGCTGATGGACATCCAGGCTTCTACTGTGGTCACTTACGTTTATCAACTAATTGGAGAT GACGTCAAAGTAGAACGAATTGAGTATAAAAAGTCGTAAAGCCAGGCTGGTCTCCACCACTTATTTTGTC CTCATTTCATTGTTTAAATCAAATAATTAAACACTTAAGAGGCACACAGTTGTATCACTTTTATAATACT TTGCACTAAAAAGTCTTCTCTGTTAATCCATAGTTGCTCTAAAGCTTCTTGTAAACTGTTAAGAATATAT TTAGTTTGCAGTGTATGGTTTCTGTAAGAAGCAGCCCACCCAACAGTGCAGGGCCACTTTAGGAAGTTGT CCTTGTAAATAGCCTCCTACTTGGTATTTGGACTTCATTACAAAACTAGCGCATGAAGAGAAAGAATCCA GACTTTGTGTGTATGTTTTCTCTTCTCTGGTAATAAATGTGTACCTTCCATTTAAAAAAAAAAAAAAAAA AAAAA
Restriction Sites RsrII-NotI     
ACCN NM_019780
Insert Size 549 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC005663, AAH05663
RefSeq Size 985 bp
RefSeq ORF 549 bp
Locus ID 56433
UniProt ID Q9QZ88
Gene Summary Acts as component of the retromer cargo-selective complex (CSC). The CSC is believed to be the core functional component of retromer or respective retromer complex variants acting to prevent missorting of selected transmembrane cargo proteins into the lysosomal degradation pathway. The recruitment of the CSC to the endosomal membrane involves RAB7A and SNX3. The SNX-BAR retromer mediates retrograde transport of cargo proteins from endosomes to the trans-Golgi network (TGN) and is involved in endosome-to-plasma membrane transport for cargo protein recycling. The SNX3-retromer mediates the retrograde endosome-to-TGN transport of WLS distinct from the SNX-BAR retromer pathway. The SNX27-retromer is believed to be involved in endosome-to-plasma membrane trafficking and recycling of a broad spectrum of cargo proteins. The CSC seems to act as recruitment hub for other proteins, such as the WASH complex and TBC1D5. Required to regulate transcytosis of the polymeric immunoglobulin receptor (pIgR-pIgA) (By similarity). Acts also as component of the retriever complex. The retriever complex is a heterotrimeric complex related to retromer cargo-selective complex (CSC) and essential for retromer-independent retrieval and recycling of numerous cargos such as integrin alpha-5/beta-1 (ITGA5:ITGB1). In the endosomes, retriever complex drives the retrieval and recycling of NxxY-motif-containing cargo proteins by coupling to SNX17, a cargo essential for the homeostatic maintenance of numerous cell surface proteins associated with processes that include cell migration, cell adhesion, nutrient supply and cell signaling. The recruitment of the retriever complex to the endosomal membrane involves CCC and WASH complexes. Involved in GLUT1 endosome-to-plasma membrane trafficking; the function is dependent of association with ANKRD27 (By similarity). Has no activity towards p-nitrophenylphosphate, p-nitrophenylphosphorylcholine or phosphatidylinositlphosphates or a phosphorylated peptide derived from retromer cargo (in vitro) (PubMed:21629666, PubMed:15965486).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...