Derl1 (NM_024207) Mouse Untagged Clone
CAT#: MC200453
Derl1 (untagged) - Mouse Der1-like domain family, member 1 (Derl1), (10ug)
CNY 2400.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110021N07Rik; AI195141; AW551338; Derlin-1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC003454 sequence for NM_024207
GTCCGAATTCGGTGGCGCCACGTCCGTCGGTCTCCGCCTCCTGCACAGCGGCTGCGCCTCCACTTTCCCT GGCCAAGCCGGCCGCGGAGCGCGGGGTGGGCACGGGAGGACGCGCGGCGCTGCGCAGCCGGTCACCTGAC GGGCGACCATGTCGGACATCGGGGACTGGTTCAGGAGCATCCCGGCCATCACGCGCTACTGGTTTGCTGC CACCGTTGCTGTCCCCTTGATCGGCAAGCTCGGCATCATCAGCCCGGCCTACTTCTTCCTCTGGCCCGAA GCCTTCCTCTATCGCTTCCAGATATGGAGGCCGTTCACTGCCACCTTTTACTTCCCCGTGGGCCCAGGGA CTGGATTTCTGTATTTGGTCAATTTATATTTCTTATATCAGTATTCTACTCGGCTTGAAGCAGGAGCTTT TGACGGGAGGCCAGCAGACTATTTATTCATGCTTCTCTTTAACTGGATCTGCATCGTTATTACTGGCTTA GCAATGGATATGCAGCTGCTGATGATCCCTCTGATCATGTCAGTGCTCTACGTCTGGGCCCAGCTGAACA GAGACCTGATCGTGTCGTTCTGGTTCGGAACGCGATTTAAGGCCTGTTACTTACCTTGGGTTATCCTTGG ATTCAACTATATCATTGGAGGCTCGGTGATCAATGAGCTCATTGGAAACCTTGTCGGCCATCTTTATTTC TTCCTGATGTTCAGATACCCAATGGACTTGGGAGGAAGGAATTTTCTGTCCACACCTCAGTTTTTGTACC GCTGGCTACCCAGTAGGAGAGGAGGGGTGTCAGGATTTGGTGTGCCCCCTGCTAGCATGAGGCGAGCTGC TGATCAGAATGGCGGAGGCGGGAGACACAACTGGGGCCAGGGCTTCCGACTTGGAGACCAGTGAGGGGCA GCCCTGGCCTGCTCACCAGCCATGCCGAGCAGATGACAGTCTCCTCCCAGTGCTGGGCATGCTTAGTGGC CGAGCTCTTGCTGCCGCTCTTGGACCTGACCCACACTGAATGTAGTCTTTCAGTACAAGACACATTTTTA AGTCCTCAAGGAAAATACAAGTGTTCCTCAAGTTTCATGATTCTCATTCAAGTCCTTACTGCTATGAAGA ACAAATATCAGCTGTGCAGATTTCAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_024207 |
Insert Size | 756 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC003454, AAH03454 |
RefSeq Size | 1166 bp |
RefSeq ORF | 756 bp |
Locus ID | 67819 |
UniProt ID | Q99J56 |
Gene Summary | Functional component of endoplasmic reticulum-associated degradation (ERAD) for misfolded lumenal proteins. May act by forming a channel that allows the retrotranslocation of misfolded proteins into the cytosol where they are ubiquitinated and degraded by the proteasome. May mediate the interaction between VCP and the misfolded protein. Also involved in endoplasmic reticulum stress-induced pre-emptive quality control, a mechanism that selectively attenuates the translocation of newly synthesized proteins into the endoplasmic reticulum and reroutes them to the cytosol for proteasomal degradation. By controlling the steady-state expression of the IGF1R receptor, indirectly regulates the insulin-like growth factor receptor signaling pathway.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203204 | Derl1 (tGFP-tagged) - Mouse Der1-like domain family, member 1 (Derl1) |
CNY 2850.00 |
|
MR203204 | Derl1 (Myc-DDK-tagged) - Mouse Der1-like domain family, member 1 (Derl1) |
CNY 2400.00 |
|
MR203204L3 | Lenti ORF clone of Derl1 (Myc-DDK-tagged) - Mouse Der1-like domain family, member 1 (Derl1) |
CNY 4750.00 |
|
MR203204L4 | Lenti ORF clone of Derl1 (mGFP-tagged) - Mouse Der1-like domain family, member 1 (Derl1) |
CNY 4750.00 |