Npc2 (NM_023409) Mouse Untagged Clone

CAT#: MC200435

Npc2 (untagged) - Mouse Niemann Pick type C2 (Npc2), (10ug)



  "NM_023409" in other vectors (4)

CNY 1200.00

CNY 2000.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Goat Anti-Npc2 (mouse) (aa21-33) Antibody
    • 100 ug

CNY 5371.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2700012J19Rik; AA408070; AU045843; HE1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC003471 sequence for NM_023409
GCTCGGGCTGCTTTTCCTTCCTAGATTGCAGAGCTTTCATATCCACGATGCGTTTTCTGGCCGCCACGAT CCTGCTGCTGGCGCTGGTCGCTGCCAGCCAGGCGGAGCCCCTGCACTTCAAGGACTGCGGCTCTAAGGTG GGAGTTATAAAGGAGGTGAATGTGAGCCCATGTCCCACCGATCCCTGTCAGCTGCACAAAGGCCAGTCCT ACAGTGTCAACATCACCTTTACCAGCGGCACTCAGTCCCAGAACAGCACGGCCTTGGTCCACGGCATCCT GGAAGGGATCCGGGTCCCCTTCCCTATTCCTGAGCCTGACGGTTGTAAGAGTGGAATCAACTGCCCCATC CAGAAAGACAAGGTCTACAGCTACCTGAATAAGCTTCCGGTGAAGAATGAATACCCCTCTATAAAACTGG TGGTGGAATGGAAACTTGAAGATGACAAAAAGAATAATCTCTTCTGCTGGGAGATCCCAGTTCAGATCAC AAGCTAGGCTCCTTGGCGCCTGTGTCTGTGTGGGCTGAGAGGCCATGGACGGAGTGGGGGGGAAGAAACA GAAATCAGACCCGAAATGGAATCAGTGCCATATGATGAACAGAATTTCAAGAATGCTGTTTTATGCCTTT TAACCTCCAAAGCAGTAACTGCAAGCCTACTACTCTTGAGAGCGCGCTCAGAGCCATTGTCCCCCGAGAT AGCCTCTGGGGAGGCTTCGGGAGGGAAAGGGGAAACTGGAAAGATTAGATTGGTGTCCATGGCTGTTTGC TGTTGGATTACAGGCAGGTTCCACCAGACAGGATGGGACGGGGTTGCTTAGGGATGTCAGATAACTTGAC CCAGGGCTATGGATCCACTGTGAAGGATGGCTTCCCAGAGTCTTCTGGCTGCCTGGGGGTGTTACCTCCC CTGTTTCTAAGTGCCTCCTGAGTCCCCAGCCCCTGGCTTATCAGTCAGATGAGTCTCCTTGGTAGCCTCT GCCCCATCGCTTCAGCAGTAGCGACTAGCTCTCCTCGGTATCCAGACTGGCTGAGGGGCAGTCTGCCGCA GAAATTTGTCTCTGAGTGGCTGTGTCTTTGTGGTTAGCTCTCGTTCTTTGGTAGTTTTCATTAAAGCCAA TACTTGGTTGCAGGTGCTTGGTTTTGTTTTTTAACGGTATTTGTCTGTATCCTCTCTCTGCATGTAAGAT TGAGCCTCCCCATAAATTTTAACTTGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_023409
Insert Size 450 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC003471, AAH03471
RefSeq Size 1252 bp
RefSeq ORF 450 bp
Locus ID 67963
UniProt ID Q9Z0J0
Gene Summary Intracellular cholesterol transporter which acts in concert with NPC1 and plays an important role in the egress of cholesterol from the lysosomal compartment (PubMed:12591949, PubMed:17018531, PubMed:21315718, PubMed:26296895). Unesterified cholesterol that has been released from LDLs in the lumen of the late endosomes/lysosomes is transferred by NPC2 to the cholesterol-binding pocket in the N-terminal domain of NPC1. May bind and mobilize cholesterol that is associated with membranes. NPC2 binds cholesterol with a 1:1 stoichiometry. Can bind a variety of sterols, including lathosterol, desmosterol and the plant sterols stigmasterol and beta-sitosterol (By similarity). The secreted form of NCP2 regulates biliary cholesterol secretion via stimulation of ABCG5/ABCG8-mediated cholesterol transport (PubMed:21315718).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...