Rabac1 (NM_010261) Mouse Untagged Clone
CAT#: MC200290
Rabac1 (untagged) - Mouse Rab acceptor 1 (prenylated) (Rabac1), (10ug)
CNY 2400.00
Cited in 1 publication. |
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2310040I06Rik; Gbpap1; PRA1; prenylin |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC008242 sequence for NM_010261
GTCCCGGCTGGGGTGGGGCCGCCTAGGTGCTGCTGGGCTCCGGGCTATTTACAGCGGTTCTATCCACTGC AGTGCAGACATGGCGGCCCAGAAGGACCAGCAGAAGGATGCCGAAGGGGAAGGGCTGAGCGCCACGACCC TGCTGCCCAAGCTGATTCCATCCGGCGCAGGCCGAGAGTGGCTGGAGCGGCGCCGGGCGACCATCCGGCC CTGGGGCACCTTCGTGGACCAGCAACGTTTCTCGCGACCCCGCAATGTGGGAGAGCTTTGCCAGCGCCTG GTACGCAACGTGGAGTATTATCAAAGCAACTACGTGTTCGTGTTTCTCGGCCTCATCCTGTACTGCGTGG TGACATCTCCCATGCTGCTGGTGGCTCTGGCTGTCTTCTTTGGCGCCTGTTACATTCTCTATCTGCGCAC GTTGCAGTCTAAGCTTGTACTCTTTGGCCGGGAGGTGAGCCCAGCACATCAGTATGCCCTGGCTGGTGGC GTCTCTTTCCCCTTCTTCTGGCTGGCCGGTGCTGGCTCTGCTGTCTTCTGGGTCCTGGGAGCCACGCTGG TACTCATAGGCTCCCACGCTGCCTTCCACCAGATGGAGCCTGCAGATGGCGAGGAGCTGCAGATGGAACC TGTGTAAAGTGTCCTCCAGGACCTGCCGGCCTCTCCTGCCGGCCGGCTGTCCCATCTCTGTCTGTTCTCG TCCTACCTGGCCTTGCTGCTCAGCTCCGAGCCTTCCACCTGAGGCCTCAAACCCAGGGAGGGGCTTTTGT CTTTGGAAATAAAGCTGTTACAATTGCTAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_010261 |
Insert Size | 558 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC008242, AAH08242 |
RefSeq Size | 818 bp |
RefSeq ORF | 558 bp |
Locus ID | 14470 |
UniProt ID | Q9Z0S9 |
Gene Summary | General Rab protein regulator required for vesicle formation from the Golgi complex. May control vesicle docking and fusion by mediating the action of Rab GTPases to the SNARE complexes. In addition it inhibits the removal of Rab GTPases from the membrane by GDI1 (By similarity).[UniProtKB/Swiss-Prot Function] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Di-arginine and FFAT-like motifs retain a subpopulation of PRA1 at ER-mitochondria membrane contact sites
,null,
PLoS ONE
,PubMed ID 33259547
[Rabac1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201709 | Rabac1 (tGFP-tagged) - Mouse Rab acceptor 1 (prenylated) (Rabac1) |
CNY 2850.00 |
|
MR201709 | Rabac1 (Myc-DDK-tagged) - Mouse Rab acceptor 1 (prenylated) (Rabac1) |
CNY 2400.00 |
|
MR201709L3 | Lenti ORF clone of Rabac1 (Myc-DDK-tagged) - Mouse Rab acceptor 1 (prenylated) (Rabac1) |
CNY 4750.00 |
|
MR201709L4 | Lenti ORF clone of Rabac1 (mGFP-tagged) - Mouse Rab acceptor 1 (prenylated) (Rabac1) |
CNY 4750.00 |